header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-63
Transcript Name: cdc14ab-202
Previous Names: cdc14ab-002, dkey-168j9.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046086 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046086|OTTDARG00000016695|ZDB-GENE-070705-309 cdc14ab|OTTDARP00000036366 DKEY-168J9.1-002 LG_none BX908733.16,CR751228.20 Danio rerio protein_coding NOVEL, 510 bp
GCGCACATTCGGATGGTCGAGGGTCCAGAGCCGGTTCTGC
TGAACCTCCATGAAGGCATGTCAGACGCTGGATCCTGGAG
GTCCCAGGAGAACAGCGAATGGAGCCAGTCGCCTGCCGCC
GTCCACAAGGTCTGGATCTCCTTAATTGGTGATCGACTGT
ATTTTGCAACCTTACGAAGCAAGCCGAAAAGCACAGCAAA
TACGCATTACTTCAGCACAGATGAGGAGTTTGTGTACGAA
AACTTTTATGCTGATTTTGGACCCCTCAACCTTGCTATGC
TGTACAGATACTGCTGTAAACTCAACAAAAAGCTGAAGTC
GTTTACACTGACCAGAAAGAGGATTGTGCACTACACCAGC
TTTGACCAGCGCAAAAGGGCTAATGCCGCAGTGCTGATCG
GCGCTTATGCTGTGATTTACCTGAAGAAAACACCAGAAGA
AGCCTACAGAGCCCTGATCTCCGGCTCCAATGCCTCCTAT
CTTCCTTTCAGGGATGCTTCATTTGGAAAT

cdc14ab TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cdc14ab-201 (1) 4436
cdc14ab-202 510
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdc14ab-202 Contained in:

OTHER cdc14ab-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046086 (1)
  • Ensembl_Trans:ENSDART00000149051 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB844517 (1) 510 bp
    CITATIONS (2)