header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-545
Transcript Name: canx-201
Previous Name: canx-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049537 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049537|OTTDARG00000034887|ZDB-GENE-040426-2797 canx|OTTDARP00000047792 canx-001 LG_none BX530081.6,CT990569.7 Danio rerio protein_coding KNOWN, 4225 bp
CACACGTGATGCGCTTGTAGTCGCAGGCGGAGTGCAGCAT
CAGTAAGCACGGACTATGGAGCTGAAGATGCGGTTATGCG
TGGCGCTGCTCTCTCTGAGTCTGTGTCTGCTCCTCATGGG
ACCTGTGAGAGCGCAGGAGGAGGAGGCTGATGACATGGAG
ATGGACGTAGAAGATGCCATCGATGACATGCAGGAGGAAG
ATATCGAAGAAGAGGAACAAAAAGCCCCTGCCCCACCGTC
AGCACCCACTGTGACATATAAAGCTCCAGAGCCGATGGGA
GAGCACTACTTCGCTGAGGCGTTTGATAAAGGAACACTTC
AGGGATGGGTTTTATCTCAGGCCAAGAAGGATGGCATCGA
TGAAGACATTGCCAAATATGACGGTAAATGGGAGGTTGAG
GAGATGCAGGACTCTAAACTTCCAGGAGACAAAGGTCTGG
TGTTGAAATCCAAAGCCAAGCACCATGCCATCTCTGCCCT
CCTACTGCGACCTTTTACCTTTGACACCAAACCACTCATT
GTCCAGTATGAAGTAAACTTCCAGACTGGAATTGACTGTG
GTGGGGCTTATGTTAAACTGCTGTCTCAGACTCCTGACCT
CGACCTGGAGGAGTTTGTGGACAAGACTCCATACACCATC
ATGTTTGGGCCTGATAAGTGTGGTGAAGATTACAAACTGC
ACTTCATCTTCAGACACAAGAACCCCAAAACGGGCGAGTT
TGAGGAGAAACATGCTAAGAAACCTGACTCAGACCTTCGC
TCATACTACACCGACAAGAAGACGCACCTCTACACACTGG
TGTTGAACCCTGATAACACTTTTGAGATCCTGATCGACCA
GACTGTGGTGAACAGCGGCAGCCTCTTGAATGATGTGACT
CCCCCTGTCAATCCTCCTGCCGAGATCGAGGATCCCGATG
ACCATAAACCTGAAGATTGGGATGAGCGACCCAAGATCCA
GGACCCAGATGCTGTGAAACCCGAGGATTGGGATGAAGAT
GCACCTGCTAAGATTGCGGATGAAGATGCAGTGAAACCTG
ATGGCTGGTTGGACGATGAGCCCGAGTACATTAGTGATCC
TGATGCCGTCAAGCCAGAGGACTGGGATGAAGATATGGAT
GGTGAGTGGGAAGCACCTCAGATTCCAAATCCAGTCTGTG
AAACAGCCCCCGGTTGCGGTGCTTGGGAGAGACCAATGAT
CGACAACCCCAACTACAAGGGCAAGTGGAAGTCACCAATG
ATTGACAACCCAAATTATCAGGGTGTGTGGAAGCCCAGGA
AGATCCCAAACCCAGACTTCTTTGAGGACCTGCACCCCTT
CCGTATGACTCCATTCAGCGCTGTCGGTCTGGAGCTCTGG
TCCATGTCTTCTGATATCTTCTTTGACAACTTCTTCATCA
CTTCTGATCGTAACGTGGCGGAGCGATGGGCCAATGATGG
CTGGGGTCTGAAGAAAGCTGCAGAGGGAGCCGCCGAGCCT
GGTCTGGTGAATCAGATGATCACAGCTGCTGAAGAGAGAC
CCTGGCTCTGGATCGTCTATGTTCTGACTGTGGCTCTGCC
TCTGGTGCTCATCATCGTCTTCTGCTGCACTGGAAAGAAG
AGCTCAGCGTCTACACCTGCTGCAGAGTACAAGAAGACTG
ATGAACCGCAGCCAGACGTGAAGGAGGAAGCTGAAGAAGA
GGAAGCCAAGGATGAAGAACCAGAGGCAAAGAAGAGTGAA
GAAGAGGACTCCACAGGAGATGGAGATGGAGACGATACCG
CAGAGAATGGAGACAAAGATGACAATACATCTAATGAGAA
ATCAGAGGATGACATTCTGAGAAGGTCTCCCAGAAACAGG
AAATCAAGAAAGGACTGATGGACTTCCTGAATCTGTTAAA
GTGCAAAAAGTTCCTCTCCTCTCATCCCAACATCCCTCTT
CCCCCATTCCGGGTCCTTCTCCATCTTTCCTCCCTTACAC
CCCTGCTCCCCCATATTCCCCATACTCTTCTGCTGCGACG
ATAGTCAAAGTGAAACATTACGCTCCACCACACAACCAAC
GGCGAAACCAACCACCTCAACCCTTTTCTAGAGGATGTTG
ACGGCTACCACATTCAACGGCATAGAAACTTTCTCCGTAT
CTAATAAGGAAACAATCTTTGTTACCATTCCTGAACTGTG
CATCTGACGTTTAAGTAAAAAAATCCTACTCTCACACTTC
CAGACAGTGTTCCTAAACCAGAACAACACTATGGCACACT
CGGTATTGTAAAGTTTACAGGCCAACAGCTTTATACTTTT
GTTCTAGAGTAATGCGCGAGAAGCCATAGAAGGGCGAGAT
GACAGGATATATTATTATGAAGAACTCTAAAAGCCGACCG
CTTAGCTATATAACACGTAAATGAGAGGTTTTCATCATTT
TTTATTCCGTGAGGTTGATCTTTTTTTTGTCATGGCGTAG
ACTGGGCGTCCAGTAGAAAGCCAAACCGTGAGCTGAACGC
AGCCGGACATGTACTGCACGTGCTCAGTAAAGTATCCAGC
AGGGAGATTGCCAGCTAGATTAGTAGGTTCTAGATTTGTA
CTGCCTTACTTGTAGGACACAAGATTTGCTAATATTTTTG
TTTTGGTTTCTGTGAATGTACTGTGAGTTTGTTTGTTTGT
TTTGGTCTAACGTTTTTCTTTGTTTTTGTTTATTCGAATG
GACTTTTTACTAAATCGTGAATTGCTGTACAAATGTGTTC
TCTGACGTAGATTTCTAACCTGTCCAGCCCAACAACGGGA
CAGATTTTTTTTTATTTGCGAATATTTTACTTTCTCGCGT
TCATTTATTTGTCTGATCGAAAACTGGTGAACTGTTTATC
TACTACTCTCGATGTGATGTCATATCCTATCCAGCCATGT
TCAGCGGCAGCAGCAGCAGCTTCCTGTTTCATTGAACCAA
TTACATTCACACCACATGAGAACGAGAGGACTAAGGGACC
GTTTATTGGTAGGTATTTCTAATTCAAGCTTTTGAGGGTG
GATCTCAGGAAAATGTCACGTTTTTAGCGTGAAGGTGAAA
ATACATCGTATGTATGGTGGTGTTTTTACAATTTCAAGAT
TGTTAAATGTGAAAATTCTGTCATTTACTCACTCTTTACT
AGTTCCAAAGTGGTTTTTAGTTTGTTTATGGTGTTGAACG
TAAAATAGGATACTTTGAAGAATGCTGGAAACCTGTAACC
ATTGACTTCGATAGTATTTGTTTTTCCTATTATTTAAGTC
AATGACCAAAATATATTATTAGCGTTCATCATCAGAATAA
AAACAAAATTTATAATGGTTTAAAACCACTTGGTTAACAC
AAATTTTTGAGTGAACGATACCTTTAAGTTTGGATATGGT
TTAGCATTTGACTTTACATAACCATTACAAACTGTAATCT
TATTTTTGTCAACCACATCGATGTATAAATGGTTATTTCA
CTTGACTGTGCTTAATTGTACATCTTTATCATTTTAATTT
TACATTCCCGGTGACATTTTTGACGTCAATTTTGTGAGAT
TCACCCTCAGAGTTTTCTTGTAAGTGTCAATCGAAGAGAA
AACATGAAAGTCCTGGGTGTAAAGCAAACTGTTTTGGAGT
TCCGATATTTTGCATCGACTCTGCCCCTAGATCCTAGACC
CCAAAGATAAGAAAAATGGCACTATTAGGGGGCGTACCCT
GATCAAATGAAAACTAGCATACGATTTATCGCTAGTTTTA
TAAAGTTACTTGTTTGTACTCTCAATATGGCCTCATCAGT
TGCTCTTCCATCGTAACGGATCAGGTGAGATGCCGTAACA
TGAGCTCTACCCCAAGACTAATGAGAGTTGGCACTTTCAA
AGGTAACTGAGAAATGGAATGAATTAAAAAAAAGAAAATC
ACTCATCATGTAGGCCAATATCTGCTGCTCTGCTGTTTTA
ACGTCTCGCTTCATCTGCTTGGTGTTGTCTGCAACCATTA
ATGTGCTGTCTGTATACCTGTCTTTTGGGCTGTTGTTGTT
TTCTTTCTTTTGTTTTTGGATTACCATTATTTCACAAATG
TAGGTGATTTAATAGTGTGGATGGATAGAAGGATGGAGAG
TTATTGAGTGATTTACTGGCATCATTGAAGTTGTGAATTT
AAGATCATGAGTCTGGATGAGGATTCTGGTCTTGCTGGGA
CGGTTTGGGGGGGGGGGAATCCATCATGTTACTCACAAAC
TAAAATAAACTGATTTGACGAATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
canx-201 Contained in:
OTHER canx-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049537 (1)
  • Ensembl_Trans:ENSDART00000089021 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC054903 (1) 4220bp
    GenBank:EV759902 (1) 945bp
    GenBank:DN862259 (1) 784bp
    GenBank:EB775991 (1) 448bp
    GenBank:EB773225 (1) 369bp
    CITATIONS (2)