header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-41
Transcript Name: calub-201
Previous Name: calub-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039520 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039520|OTTDARG00000028875|ZDB-GENE-040426-1251 calub|OTTDARP00000031612 calub-001 LG_ CU467655.8 Danio rerio protein_coding KNOWN, 2541 bp
CGGTCCTTCCAGGGGAAGCGTCTAAAAACTAGTAGTTGGA
CATCCGGAGTTACTGAGATATTAGCCGGGCGGCGTGAAAA
ACTGCACATTTTCGTGGTTTTCTATTGATAAAGTGTCGGA
GAAGATGGAGCAGTGGCCGCTCTTGTTTTTCGTCGCCCTC
TGCATTCTTCAGTCCTCCAGTAAACCGATGGAGAAGAAAG
ACCGTGTTCATCACGACGTTCCTCTCAGTAACAAAGATCA
CGATGATGAGGAGAACTTCGACTACGACCACGAGGCTTTT
TTGGGACAGGAGGAGGCCAAGACTTTTGACCAGCTCACGC
CAGAGGAGAGCAAAGAGAGGCTTGGTAAGATTGTAGAGAA
GATCGATGAGGATCACGATGGTTTTGTGACTGCCGATGAG
ATGAAGCGGTGGATCAAACACGCTCAGAGGCGCTGGATTT
ATGAGGACGTGGACCGACAATGGCAGGCTCACGATCTCAA
CTCAGACTCTTTTGTCTCCTGGGAGGAATACAAGAATGCT
ACGTATGGTTACATACTTGATGAAGCAGATCCTGAGGATG
GTTTTAACTACAGACAAATGATGACCAGAGATGAGCGACG
GTTTAAGATGGCCGACCAAGATGGTGACCTGAGGGCCAAT
AAGGAAGAGTTCACAGCATTTCTTCACCCAGAGGAGTTTG
ACTACATGAAGGATATTGTAGTACTGGAGACCATGGAGGA
CATTGATAAAAATGGAGATGGTTTGATCGATTTGAATGAA
TATATTGGTGATATGTACAGTCAGAACGGAGACTCGTCTG
AACCAGAGTGGGTGAAAACAGAAAGAGAACAGTTTACAGA
ATTCAGGGATAAGAACAAAGACGGTCGTATGGATAAAGAC
GAGACCCGTGACTGGATCTTACCTGCTGATTACGACCACG
CAGAGGCGGAGGCCAAACACCTGCTGTACGAGTCCGACGC
AGACAAGGACGGCCGTCTCACAAAGCAGGAAATTGTGGAT
AAGTATGACTTATTTGTTGGGAGCCAAGCAACAGATTTCG
GCGATGCTCTGGTGCGACACGATGAGTTTTAACTTTATGA
ACTTTGCGCTTGAAAACAAATGCAAAATGAACAATAATTT
ATTTTATCATTTCAAGCATCCCACGGTGTGAAACTGTACT
GTGTTTGCAAAACATTTCTGTTCTTCTACAGCAGCGACTC
CATCAAATCCAGCTTGATTTGCCTTTTTATATACATCTCC
AGCTCTTCGCTCTTGGATTCTGATGCGATTTCAAATGCAC
TGATGAAATAGTATTCAGATCAGCTTGTGAAGCTTTTGGA
GAGGTTTGTCTAACGATTTATTATGCACCCCGTGTAATGC
AGCATAATGGCATACATGTAAACCAACCCAGCCAAGAGTA
ATAACATTAGATATAAGAGGAGTTCTTGCGCATAATATGA
CCTAAGCATTGCCCTTATGTACACTACTTGTCTAAATAAT
ATCAACCACTACATGTACAGTTCATATTTATCTGCATTTA
CCATAGTGAAAACCACGTATAGTATTAGATCTTAGAGAAT
TTTAGATTTGGTTGACGGGGATCAGCATGTCATGGCTTGA
GCTGATCTGTCATCAGCCTCGCTTTAATATTTAGTCATTA
AAGGAGTAGTTCACCACAAAATATAAATTCTGGCCTTATT
TACTCCGCATTCATCCTTGTTTTAAACCTTTTTTCTGTTG
AAGACAAATTAAGATATTTTGAAGAATGTTGGAAACCTGT
AACCATTGACCATTATTATTTTTTTCTCCTATGAAGGTCA
ATGGTTACCTGTTTTCAGCTTTCTTTAAAATATCCTTGGT
GTTCAACAGAAGGAAGAAACACTTAACTAACTAACTACAC
TTGGTAACTACTTGAGAATAAGATGAGAAATGAGTAATTT
TTTGGGGGGTGAACGATCCCTTTAAATGCAAGGACCATTC
AGCCTTAAAGGACCACTGAACATCGTTTCTTCCACTGCTA
CATTTATTTAGTGTTTTTGCTTTCAATAATAGACTGAAGC
AACAAACTAATGATCATCTTCCCTCAAGTGCCTTTTCAGT
CTCCCTCATATCCTGTAAATGGCTTCAAGGCTGTTATGAA
AACTTTTTCTTTCTTTCTGCGAGTTGTACATGACTGAACC
TCTCTTAAAGGGATAGCTCACCCCAAAATTCAAAATTTGT
CATAATTTACTCAACCTAGATTTATTCCAGACCAGTTTTG
TTGAAGATATACTGAGAATGTCAGATACTGGTGACCATGG
ATTTCCATTGTGTGGTTCATATTCATTTTCAAGTCAATGG
TTACCGGTTTTCAACATTCTTCAAATTATCTTCTTTTGAC
TTCAACAAAACTGGTTTGGAATAAGTAAATGATGACAATT
GTAATTTTGGGGTGAACTATCCCGTTAACATTAGAATATA
GTTCGTGTATATATGTCTATAATTGAATGTGAATTCCATT
CAGTATGCTGTGGTCAGGTATTGTAAATACTAAGAGTGTT
TTCTCAATAAAATTGCTTAAA

calub TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA calub-201 2541
calub-203 (1)    Ensembl 729
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
calub-201 Contained in:
[BAC] DKEY-88E18 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000039520 (1),  Ensembl_Trans:ENSDART00000005405 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC055227 (1) 2532 bp
GenBank:CK713033 (1) 331 bp
CITATIONS (2)