header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-404
Transcript Name: cd276-203
Previous Name: cd276-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049085 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049085|OTTDARG00000034656|ZDB-GENE-070112-452 cd276|OTTDARP00000038520 cd276-001 LG_none CU651632.8,CU896640.11 Danio rerio protein_coding KNOWN, 2136 bp
GAAAAAATTGAACCAGCTGGACTCGAGCAGCCGCTGTTTC
CCTCATCATCATCATTTCTGCGGATAAACATGAGCTTCCA
GAGAGTTCACCGGAGCTGAGGGCCTGATCGGGAATGCCGG
AGCCCGCAGAGAGTGCCTTTTCCCCGGTCTGCTGATACAG
AGAAGCCGCGTGTCGTGATTGAAGGATCTGCCCTGCTGTC
TCACACACACACACACTCTCACGTCTGCGTCGTCATGTTG
GCCCTCCTGCTGTTTTCTCTGCTGGTGCTTCAGTCTCACG
CTCTGGATGTGCGTGTCCCAGAATCCCCTGTGGTGGTTCT
GTTTGGGTCGGATGCGCTGCTGAACTGCTCTTTTTCGGGT
GTTTCTGCGTTCAATCTGTCGGATGTGAGTGTGTTCTGGC
AGCTTTCGGACACTAAGCGCTCCGTCCACAGTTTCTGGAA
GAGTCAGGATCAGCTGACGGATCAGGATGAGCGTTTCTCC
GGCCGCACCACGCTGTTTTCGGATCAGCTGATGGTTGGAA
ATGCCTCGCTGCGCATTAGGAAAGTGCGCGTGGCAGATGA
GGGAACGTACTCCTGCTTTGTTAGGGTGCAGTCGTATGGG
AGCGCTGCCGTCATCATGCAGGTGGCAGCTCCGTTCTCCA
AGCCGCTGGTGTCCTGGGACTCGGACTCCAGTCTGAAGCC
GGGTGATGCGGTGTCCCTGAGCTGTGTGGCGTACGGCGGG
TTCCCACAGGCGCAGCTGCAGTGGCAGGACGGATCCGGAC
ACAACCTGACAGAGAACATCACTGTCTCCCAGCTGGCCAA
TGAGGAGGGGTTATTCAGCGTCAGGAGCGTCCTGAGCGTG
CATCTGGAGCCCAACAGCACATACAGCTGCAGAATCACCA
ACCCACTGCTGGGGGACGAGAGCCAGGCCTCGGTCACCAT
TACCGGCCAGCCTCTGGTGTTTCCTCCAGTGGCTCTGTGG
GTGACTGTGGCTCTGGCTGTGTGTTTGTTGGCTCTGCTCA
TCGCTCTGGCCGTCGTCTGCCGCAGGAAAATCAAGGAGAG
CTGTGAGGAGATGAGAGCCGAAGAGGAAGCAAAAGAACTG
GAGGAAGCCAGAGTATTAGAAGAAGCCAAATCAGAAGCGA
CTCCTCTGAAGAGCTGAAGCTGACGCTCAGCCTAATGAAC
TGACGCTCAGTGAGAGACTCAGCAAAATCATGGCTGTCGT
AAGGGATCAAACACACACACACACACACACACACACACAC
ACACACACGGACACCAGAAACATCCCTTTTTCATGAGGAT
GAAGATAAACCGTGATGCTGAAACACTCATCTTTCATCAA
AGTTCTGGGGGACTTTTCTAAGTAATTATTAATGCATCAC
TTTAAAATTTTAAGTTATAATATTTTAGTGACTTTAAAAA
AGGTGATGTAAATTACTTTATAGTTTAATTAATTGGCTTT
TAAATAAATGTTGCTGGACCCTGCACTGGATGAGAGAATG
CTGGAATGGGCAGAACACATGGATGAAAAGGAAAAGGGGA
TTATAGTGTCATGGATGTGTCTGTGTGTGTGCATGTGTGT
GTGTGTGTGTGATGTGTATCAATCATTGTGTGCAAATAAA
ATCAGCAAAACACCAAACCCAGGGCCCGGTTTTTCAAAAG
GTTTCATCCGGATAAAATCGGATTTAGTAATCCTGTTTTT
GCGATCCGTGATCACGGAATCCTGCTTACTTTTTGGGCCC
GTTTTTCAAAGCAACATCGAATTAGATCAATCAGATCCGG
ATAGGAACTTTTCAGGTTCACTAAATCTGGATAACCAGTG
CTCCAACAGGATTGGAAATCACAATGTAGAACTAAAGATA
AGTAAAGAATAAGCCAGTGTGGGGTCAATATAAGTTTATT
TTTCCACATTTTCATTACATTTTGGGCATTAAGTCCAAAA
TTCCAGTGGATTACTTTTGAAAAACCGGGCCCTGGAGCCA
GACGAGCAGCTCCACACACCGCTCCAGTTCCACACTCTCC
GTCTGTATTCAGCAGGTACTTTTAATTGTGGGTTTTCTGT
CGTCTGAAATGTGCCAAAGTATTTGGAGGCCTTATTGTAG
ACATCGCTGTGCCTGACTGTTATTGCGTATGTAAATTAAA
AGATCTCATTCTTAAA

cd276 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cd276-202 (1) 491
cd276-203 2136
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cd276-203 Contained in:
[BAC] CH73-116F3 (1) (order this)
[Fosmid] CH1073-312B22 (1) (order this)

OTHER cd276-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049085 (1)
  • Ensembl_Trans:ENSDART00000150013 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC129187 (1) 2169 bp
    GenBank:CU638774 (1) 1592 bp
    CITATIONS (2)