ZFIN ID: ZDB-TSCRIPT-110325-385
Transcript Name: si:dkey-85n7.6-201
Previous Names: dkey-85n7.6-001, si:dkey-85n7.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049028 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049028|OTTDARG00000034621|ZDB-GENE-110411-62 si:dkey-85n7.6|OTTDARP00000038472 DKEY-85N7.6-001 LG_ BX255913.8 Danio rerio protein_coding NOVEL, 4145 bp
GAAGTACTGAAGAGGTGAATCCCCAGCAGTCTACAGTTTT
TTGGGACCTACTTGAGCACCGTGTGTTCTCCGTGGCGATT
TGAGTTGCAGTTACTTCATCTCATCATGCCTGGCAAGAAA
TGAATCCTGATTCAGCGCTCGACTCGCACAGAATCGCGCG
CGGTGAGAACTTTGCTTTGCAACTCTTCTGTGGATTGGGC
ACGCGCCACGGCAGCGCGCGGAGGATCAACAACTTTCCTC
AGAAACAGCGCTAGCGTCCGTCCTATGTCGCCTCTAATCC
GTCCATGTCACCAAGTATTGTCGCTCTAGTTGGACGAGAA
TGTTTCAGAGACAATTTCTGCTTAAACTCGTGGAAAACAT
CGTTGGTAAGCCTTGAGAAGCGGATATTAAATGACTTTTG
ATGCGCCCCAGACTCGCGTCCTCGCCAGGTGGACTGTGAA
GAGACAGAAGAGGAATGTTTATCCGAAAATTATTGCCGCT
GAATTTGGGTTTTTTGACATTTTTGTTTAGTCACTGCTTT
CTCTCATTGTTTCTGCCGTTATTGCAGTTTGCAAGAGGGG
AGCTCCAGAAATCATGCTCCCGAACCACAGTGGCACCGCT
GGAAGGGAGCTGCCAGCTGCCATGCCAGTGTAGGCCATAC
CCACCGTTACCACCTCCACCCCCTCCTCCACCGCCCCCGA
GGCTCTTGGCTCCAACTGTGGCTCCCTCCACTGTATCTCC
CATGACACCATGGAGGAGAGAAATGGAGATCTTAGTACTG
GGGACTGTAATCTGTGCATCTGTGGTCTTCCTCCTCCTGA
CTGCCATCATCTGCTACAAGGCCATCAAGAGGAAACCCCT
TCGAAAAGAAGAGAACGGCACGAGCCGAGGGGAGTATGCC
ATGAGCTCACGCTGTAAACAGCAGGTAGTGGAAACCAACA
ACACTGGAGTATAGAGGCCAACATGCAGCAAGGCAAGCTA
CCCTACAGCACCACCGGCTCTCTGTTTGGGTTCACGAGAT
GGACGCAAGGTATATACGAATTTAGAAACTGTAAACTGCA
CGGCTGCCCTCCTTGGGACATTAAATGGTGTTTAGAGAAA
AGAATCAAAGCAAATAAGTGACGTGTATAGGCAAGCATAT
GTAGGATTTGAGGAGACGACACTTAGCGATGCAGGCAGCT
GCACGAGTTTCACAAGACTCAACCTGGTGGCCCTCAGGGG
CCCCTTTGAGTATAATATACAACACCAACAACAAAATAGA
CGCATGCACTTTCTGTTGAATGCAATGATGTTTTGAAATT
CCTGTCTTCTCTTGTCTTTAACTCGGTCTCTGCAGTGTTC
CTCATTAAACATTAAGGGTTCTCTCGTCTCATGTAGATTG
TGTGAGTGTTAAATAACCACATCAACCCCTTATGTTTTGA
TACGGATTCCAAGTGGATTGGTTGATTCTTCATTTTGTGT
ACCAAATATACAGTAGAGAACGAGAAGTGCTTTTCTGAAA
AGCACCCATAGATTTCTTGCAGTTTGTGTTACTATGCAAT
TGGAAAGAATTGAGTTCTTGAGGTGCATGCTGATTATACA
AAAACACAATGCTAGCATTTGCTTTGCTAATATTTAGATG
ATTGTAGATGAGTTCCTTTTATTGATATGGTGTAGATTTT
AAAGATGCTAAATGTGGCTTATTGGGAAAGAGCTCCAGTT
ATAAGTACATGAAGAAAGAACAACGGATAATGGATGAGTT
TTAAGAAAAAGTTCATTTTAAAATGAGAATTATGTTGTTA
GAGCTGATAAATAGCTTCTTTTAAATTTGTATTATTAAGA
CATTAATCTGTATTATTTTGTTAAAAATAAATCAATAAAA
AATGAATCTGTTTTGTCTTAACAATTTGAGTTAGCTGACC
CTTGAAAAGAGCAAAGATTAAAATCACTGTCTTTCTCATT
TCAATATACTTTAAAAACTCTTCATCTTTGAAACACGGAT
TATCATCATTTTAATGAAACCTAAGAGGTTTCTGTCCCCT
CAATGAACGTCTTCTTAACCATACCTGTAAAGATCCAAAA
CGCAATAACAATGTATTTGATAATACAGTATAGACCATTT
CAATGTGGTGATGTCATTGCCCTATAAACATTTCCTGCTT
GTTGTCAAACTATTTCTTTACCGTAACGATGCAATTTGAT
CATATCTTAAAACAGCCTTTATTAATCAGTATATGGACCA
TATGGACCTTTTTGGATTCTTGGAAGATATAGAAATTAAA
AGTGCAATACAAGAAATACGTTAGGACCATTGATATGGTT
TACACCTCTCAAAATGGTCTATATATTATCATTTGTAGGT
TACAGTAGTGGCGGTTGTTAGCTAAACATAATGTGGCAGA
GAATATCATTGAACATTTGAGATTATTGAAGAATTACTAA
ACATAACAGTTTGGCTCTTCAAACCCATTTTAGATTTAAC
TGAAAATTAGGCTTTGACTGAAAATGTTAATTTGCCAGTA
TTTTGGTGCACCTTTGACTGCTGGATATAATAAACAAATT
TAGTTTGATCTTTACATGTTTCCTGAAGCATTTTATCATT
TAGTTTTTTTTTTTTTTTTTTTTTTTTGAAGATAACTAAA
GTCAAATATTAAGTGAAATATTTCATTAATTTATTTTCCC
CATAAAGCTGCTCTGTTCCTCTTGAAGTTCAGACTGCATG
ATTTTAGCCCCGATTTTGACTCAGAAATCGAGAAATCGGT
GCTCGTTCACATGAGTAGTTACAGTATGTATGTTAACAGA
TAGGTCGCTGATACCTGTCAGATATTTGGCATGCTAAACA
TCTGGAGCTGTCGGTGATTTAAATCATGCTGTGTGGAATG
TATTAACATTCATGTGTGAAAATAACATTGGCAATCACCT
ACAACTAACAAGAGAGCAGCATCCACTAGTATAGGTATCT
GCTGGCCAGCTGAGGATGGGGTAGAAGTTAAAAGCGCTCA
TTTTCAGTTTATTTGGACCCAAAAAAGGGAGGAAAAACTA
GTGAAAATTTGGCAGCAGCACTCATTTCTGTTTGACATGT
CTGAGCAATACCACAACTGAGTCAAAAAAATAAATAAATA
AAAATAAAAAGATGGAGAGAAACTGCTAATTCCCATTCAA
AGCCTTATTTGATTATTGATTATACAGATTATTTGAGAAT
AAATGCTAAATATAGACTGAGAATAAGGTTAAAATGTTTG
GTCATGATAATTGGACAATTTCAAACTATTATAATAATCT
AGAAGTTTGACATTCAGTGTTACATAAGGTAATAAACTTT
TATGCCAATATTCAATTTATTACGAGAGAAAAAAACGGGA
AAGCAAATTAGAAATGATTGAAAATTAAAATGATTTTAAA
TTAAAAAAAAGTGTGCCTATATATGAGTGTGCACACACAA
ACACATAAATATATACATATAAATCTTTACATCAGTCAAT
AGAAATCAGTCACTTTTTTAAAATCGTACATTTTCATACG
ACTGAACTCGTACGAATTAGCCACTAAACTATAAAAACGT
AAAATACTTACGTTTATTCGTGAGATCAGGCTGGGTGTTT
AGTTAATTTTCGATTAATATATCTTAAATTCATTTTTTTT
GCAGACAAGAGCTTGTATTTAGAAATCAGTGATGCAATCA
ATGTTCCTGCATAGTAACACGGAACTATGAACCATAATAA
ACAAGTGAGCAATGATGATTACATCATTTACAGGCCTGTG
TAAACAGAAATCCCACTTCATGTCCCACTAAAACATTCCC
ACAATCTACTGTACAGTCTTTCACCCGTCCAACAAGATAC
ATGTACTGAAGATATATGTGTATTATATTGTACAAAAGGT
ACTCAGAATTGTATTGCATGAATGTACATATCAATATTTG
CCTTCTTGACAGTTTATTGTGTGTACAGAGTAAGAGCAAA
TGTTTATAGGGATAAGTATAAGTCGATGTGTCGTCAGAAC
AGAATAAGTTATTGTTTGTCTGGAACAAGCCATTAATGTA
TATTTGAGTAATCAGAGGTTGTTGCACAATGTATGCATCA
CATACCAAAATGTAAAACAATTATATATATATATATTGTG
CATTGAACTAATTTAACTGCAACTTGCTGACTTTTTTTAG
TTTTAAATAAAATTGTACTACTGAA

si:dkey-85n7.6 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA si:dkey-85n7.6-201 4145
si:dkey-85n7.6-202 (1) 448
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-85n7.6-201 Contained in:
OTHER si:dkey-85n7.6-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049028 (1)
  • Ensembl_Trans:ENSDART00000123950 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH448322 (1) 986bp
    GenBank:BQ258391 (1) 593bp
    CITATIONS (2)