ZFIN ID: ZDB-TSCRIPT-110325-349
Transcript Name: slc15a1b-201
Previous Name: slc15a1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048906 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048906|OTTDARG00000034550|ZDB-GENE-030131-4661 slc15a1b|OTTDARP00000038379 slc15a1b-001 LG_ BX950176.10 Danio rerio protein_coding KNOWN, 2631 bp
ACAGCTACGTCTGTCCTGGCTGGTGTGTGTGTATGTGTGT
GTGAGTGAGTGTGTCTCTACATTAAAGGATATTATCACCA
GTGGACCAGAAAACAGTCTCAGTCGGAGGAGTCACCATGG
CAGACAAAGAGGGACACAAGCAGAAGAAGGAAAGGGCAAG
TTGCTTTGGATATCCTGTCAGTATATTTTTTATTGTGGTG
AATGAGTTCTGTGAGCGATTCTCCTACTATGGCATGAAAG
CGGTGCTGGTCCTGTACTTCAAGTATTTCATTGGTTGGGA
TGATGACCTGTCCACCACCATCTACCACACGTTTGTGGCT
CTCTGCTACCTTACACCCATCATGGGAGCCATTATTGCGG
ACTCGTGGCTGGGAAAGTTCAAGACTATCGTGTATCTGTC
CATAGTGTACACCATTGGTCAGGTGATCATGGCTATCAGT
GCCATCCATGACATCACAGATGCTAACAGAGACGGCAAGC
CTGACAACAAGACCTTACACATATCCTTGTCGATGTTGGG
GCTCATCTTGATTGCTTTGGGAACAGGAGGAATTAAACCC
TGTGTGGCAGCATTTGGAGGAGATCAGTTTGAAGATCACC
AGGAAAAACAAAGAAGCACTTTCTTTTCCATCTTCTATCT
GTCCATCAATGCTGGCAGTCTGCTCTCCACTCTCATCACA
CCCATCCTGAGATCCCAGGAATGTGGCATCTACGCAAAGC
AGAGCTGTTATCCTCTGGCGTTTGGCGTTCCTGCAGCGCT
CATGGTGGTTGCCCTCATTGTGTTCGTCATAGGACACAAA
ATGTATATCATGGAGTCTCCAAAGGGCAACATCCTGCTGC
AAGTCATTAACTGCATTGGATTTGCGCTTAATAACCGTTT
CAGACATCGCGGTAAACAGTACCCAAAAAGAGAGCACTGG
ATGGACTGGGCAGAAGAGAAATATGATAAACTGCTGATTG
CACAGGTGAAGATGGTGGTGAAGGTGCTGTTCCTCTACAT
CCCGCTGCCAATGTTCTGGGCTTTATTTGACCAGCAGGGC
TCCCGTTGGACTATTCAAGCCACCACCATGGACGGTAACT
TTGGAGGGTTTGTAATTCAGCCAGATCAGATGCAGATCGT
GAACCCTATACTGATTGTGATTATGGTGCCAATCATGGAC
TCTGCAATTTACCCCCTCATCAAGCTGTGCCGCATTAACT
TCACGCCCCTGCGGAAGATGACTGTCGGTATGGTTTTGGC
AGCCTTAGCATTTGTGGCTGCTGCTCTTTTGCAGCTTCAA
ATCGACGAAACGATGCCTAAGTTCCCATCAACCTCTCAAA
CCCAGTTGAAGTTCCTGAACGTTGAGAGCACATCATTGCC
TGTTGTGGTGGAGGGACAAGATCAATTCATGGTTCCTGGA
TTCAATGCCTCAAGTGAATACTTGACCCTGGACAAGGAGA
ATGTGACCATCTCTGCTGGAGGAGTCAATGATACAGCCTT
TTTAAAGACCGGCACCAGGCACACAGTTTTAATGAATGCT
GCTGGAATGAGAAATACGCTCGATGACCTTACTAAGAAAC
CAGAGCAAGGCCTGAATGCCATTAGGTTTGTGAATGGCTG
GGAGAATCGGCTGAATGTGTCAGTGAAGTCTAATAATGTG
CACGCGGATCCCCTGGATGCATCAGTTTACTTATTGGTTC
CCCATGGCAAAGTCAACTTTACAATTTTTGACGGGGGCGA
CGGGAAGTGCCACTACATTATGCAGCTGGGCTTTGGAAGC
ACTTACACAGTCCTGATCCCCAGCACCTTCGCCTTCGGAC
AAACTTGCAGCGAGAGCTTTGAAGCAGTGCAGGACATGGA
GCCCAATAGGATCCACATGGCCTGGCAGGTCATTCAATAC
TTCCTTTTGACCTGTGGTGAAGTGGTGTACTCGGTCACCG
GCCTCGACTTCTCCTATTCACAGGCTCCGAGCAACATGAA
GTCGGTTCTGCAGGCTGGTTGGCTGTTGACCGTCGCTGTG
GGGAACATCATTGTGCTCATCGTGGCTGAAGCAGGATCTC
TTCCGGATCAGTGGGCTGAATATCTGCTGTTCGCGTCTCT
TCTGGTGGCTGTGAGCATCATCTTCGCCATCATGGCCTAC
TTCTACACCTATATCGACCCGAATGAGATCGAGGCTAAGT
TTAAAGAGTTGGAGCCCGAGGACAAGAAAAGGAAAGAAAT
GCAAATGACGGCCAAAGACAATATGGCGTACGTACACAAT
GAGAACACAAACATCAAGCAAACCAAGATCTAGACACTTT
TTTTTTTTCTTCCCTCCTGATCAGAGGTGTTCCACGTCGT
GACTGATCCAGCATTTTCTTAAACAGTTAAGTGTGGGATT
TGTTGTAGCAGAAAAGATTCTCAAATCAGCCCAAGGAAAT
GCTAATTCTTCCTAAATTGAAGTTTTGTTTGGGATGAAGA
GTGTGGGCTTGAGGGTTGGTAGTTTTGGAGGGTATCAGAC
TGTTAATGTGTCACTATCGTGTGATGGTGACTTTATTTAT
GAGTCTATTATGTTACTATCAATAAATTGATGGATCGAAA
CAAGTGTTGCTCTGACAATTGACTCTTATCATGGAAAAAC
AGTTAAAAAAAATTAAATTTAAAGTGAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc15a1b-201 Contained in:
OTHER slc15a1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048906 (1)
  • Ensembl_Trans:ENSDART00000047896 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC054899 (1) 2637bp
    GenBank:AY300011 (1) 2636bp
    GenBank:EH513393 (1) 945bp
    GenBank:EE684831 (1) 909bp
    GenBank:DN769775 (1) 849bp
    GenBank:AW175007 (1) 765bp
    CITATIONS (2)