Transcript

slc16a1a-201

ID
ZDB-TSCRIPT-110325-316
Name
slc16a1a-201
Previous Names
  • slc16a1a-002
  • ch211-105j21.7-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048772 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048772|OTTDARG00000034474|ZDB-GENE-110408-16 slc16a1a|OTTDARP00000038275 CH211-105J21.7-002 LG_none AL954307.8,BX005262.5,BX005150.5 Danio rerio protein_coding NOVEL, 2429 bp
CCATATCACAGGCCTTTATAGAAGTTTCAGCTGTTCATTT
TGTTCACTCTCTGTTTTTCATTATAGGATTATTCACATAA
CTAGAAACTTGCTTTGACCCAGACTGGTCTCTTAAAATGC
AGCTCGCCGCCACTCTGGAATAGAAGAGTACTTTGGACTG
TTTTATGCAGAGAATTTATAGACTGTACCAGAAAGAGAGT
GTGGTTTGTAAACACCTGGAGCCATGGCACCTGCTGTTGG
AGGTCCTGTTGGCTACACTCCTCCTGAGGGGGGCTGGGGC
TGGGCTGTAGTGCTTGGTGCCTTCATATCTATCGGTTTCT
CCTACGCCTTCCCAAAGTCCATTACTGTGTTTTTCAAGGA
AATTGAAGTGATCTTCAATGCCACCAGCAGTCAAGTGTCC
TGGATCTCTTCTATCATGCTCGCTGTCATGTATGGAGGAG
GTCCTGTCAGCAGTATCCTGGTCAACAAATATGGAAGTCG
TCCTATCATGATTTTAGGAGGCTGTCTGTCAGGAGCAGGG
CTCATCGCTGCCTCATTTTGCAATACCGTTGAGGGCTTAT
ACTTCTGTGTTGGTGTTGTGGGAGGTCTGGGACTCGCATT
TAATCTCAACCCAGCTCTCACAATGATCGGCAAATATTTC
TACAAAAAGCGTCCAATTGCTAATGGCATCGCTATGGCAG
GAAGCCCGGTCTTCCTGTCAACTCTAGCTCCTCTAAACAC
ATGGTTCTTCGATCAGTTTGGCTGGAGAGGGAGTTTCTTG
ATCCTGGGTGGACTTTTGCTCAATTGTTGTGTCGCAGGAT
CACTCATGAGACCTATTGGGCCAAAACCCCAACCTGCTGT
TAAGGCCGACAACAGTAACAGCCGAGCCAAAGAGCGAAAG
ACGGTGGTCGAGGTCATCAATGGTTTTATCGATCTGACAC
TCTTCAAGCACCGTGGCTTTTTGCTTTACCTTTTGGGGAA
TGTGGTCATGTTCTTCGGCCTCTTCTCTCCTCTTGTCTTC
CTCAGTAATTACGCTAAGAGCAAGCAAATTCCCAGGGAGA
AGGCGGCTTTTCTGCTCTCTATTCTGGCATTTGTTGATAT
GGTCGCACGGCCGTCAATGGGAATAGTCGCCAACACAAAA
TGGGTGAGACCGAGGGTGCAGCACTTCTTCGCTGCTTCTA
TTCTCCTCAATGGTGTGTGCCACTTGCTTGCGCCTCTGTC
CACAGACTACACCGGCTTTGTGATTTATGCCATTTTCTTT
GGGTTTGCTTTTGGATGGTTGAGCTCGGTGCTGTTCGAGA
CCCTCATGGATCTCGTTGGGGCTCAGCGGTTCTCCAGTGC
TGTCGGACTGGTGACGATTGTGGAATGCGGGCCGGTGTTA
CTGGGGCCTCCTTTACTAGGGAAGTTCAATGACATCTACC
ATGACTACAAGTACACTTACATGGGCTGTGGGATTGTCCT
GCTGATCGGCAGCTTGTTTTTGTTTGTCGGAATGGGCATC
AATTACAAACTACTGGAAAGAGAAGCAAAAGAGGAGTCCA
AGAAAGCCAATCAGCAGGATGACCCTGGAAAAGAGGTTGT
AGAGGCATTGAAAGCAGCTGAAGACAATGCTGCAGAGGAG
GCTGTGTGACACTGCTCGTTATTCTTGATCATCCTTACAT
TTCTGTACAGTCTATGGATTCGATTACAGCCAGGTCTCCA
TCTTGGACTATACAGGTTACAGAGACAGTGATGCAAACAT
TTCAGTGCCTTGCGTAAGCACATGGCCATGCACTTGATTT
ATTTTTCATTTTATTTTTAGAACTTTTCTTTAGTTCACAA
CATACTGTATGCCAATACTGTAGGAAATGAACTGTGGTAT
GTCTATTTTGAGGCATTTAGTGTACACTGAGAGAGATTGA
ATCATATCATATAAGGAATTTATCTATCTTTTTTTGGATT
TCTGACAAATAAGGCACTTGAGAAGTTAGAAAGTGGTAGA
TATGCACATTGTTTCCGTCTGTTAGTTAAACATATAACTT
AACAAATGCACTACCAGGCTCAAAAAAGACACAGTTATGT
TGATTAGATTTTTATTGCATTAATTAAAATGTTTCTGATT
TGTTAAATGTTTGGCAGCAGTTATTTTAACCCCAACTGAT
GCAGTATAGCTTTTTTCTTCTTTTAAACAACTATATCTGT
AGATGTTATATGTTCCAGGATGTTAATGCCAATATTTATC
TGGCTAATATTCTAGAATAACTGTTTATTTTAACACAGGA
ATGAACCACCAGTAACCTGAACCCCACTGAATATCTATTA
GATGTTTTAAGTAAAATGTGAAAGACTTTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGACACTA
AATATGGGTTTTCTAAACAATAACATAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations