header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-309
Transcript Name: atg3-201
Previous Names: apg3l-001, atg3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048726 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048726|OTTDARG00000034443|ZDB-GENE-030131-8576 atg3|OTTDARP00000038222 apg3l-001 LG_ CU655960.18 Danio rerio protein_coding KNOWN, 1706 bp
ATATCGCGATATCTGAAATGCGGAAGTGTCTGTCAGATGA
TTTAGGTCATGTGGTGTGGCTCGGCTAGACTGTCTTTAAA
CAGTGTAGTTAAACTCAAGCATATTTCATCAGAAAATCTC
AGCTTGATCGCCAACGTGAAGACTCTTTTTCCAGCATGCA
GAACGTGATAAACTCGGTGAAAGGCACTGCTCTGGGGGTC
GCGGAGTTTTTGACGCCAGTTTTGAAGGAATCTAAATTTA
AAGAAACTGGGGTTATAACTCCAGAGGAGTTTGTTGCAGC
AGGAGATCATCTGGTTCATCACTGTCCCACATGGAAATGG
GCATCTGGAGAAGAAGCAAAGGTGAAGCCCTATCTGCCCA
ATGACAAACAGTTCCTATTAACTCGAAACGTTCCATGTTA
TAAGCGCTGTAAACAGATGGAGTACTCAGATGAGCTGGAG
GCCATCATAGAAGAGGACGATGGAGATGGCGGATGGGTGG
ACACCTTTCATAACTCGGGTGTTACAGGGGTGACTGAAGC
TGTTCGGGAAATCTCATTGGATAATAAGGATAATATGAAT
ATGAATGTGAAGACGGGTGCCTGTGGAAATAGTGGAGATG
ACGATGATGATGAAGAAGGAGAGGCGGCAGACATGGAAGA
ATATGAAGAAAGTGGACTTTTGGAAACAGATGATGCCACT
CTTGACACAAGTAAAATGGCTGATTTAAGTAAAACTAAGG
CCGAAGCTGGAGGGGAAGATGCCATTCTACAGACAAGAAC
TTATGACCTGTATATCACATATGACAAATATTACCAGACC
CCAAGACTATGGCTGTTTGGATATGATGAGGACAGACAGC
CTCTAACTGTGGATCAGATGTATGAAGACATCAGCCAGGA
TCATGTTAAAAAAACCGTCACCATTGAGAATCACCCTAAT
CTCCCTCCACCTGCTATGTGCTCCGTACATCCATGCAGAC
ACGCTGAGGTGATGAAAAAGATTATCGAGACTGTGGCGGA
AGGAGGAGGTGAACTCGGGGTCCATATGTATCTTCTGATT
TTCCTGAAATTTGTGCAAGCTGTCATTCCAACAATAGAGT
ACGATTACACAAGGCATTTCACCATGTAGATCCCACAGCT
ACGACAACATGGATTGTTTCTGCGCTAAAGAAGCGGCGAC
AATACGAACCTCGAAAGACTCTCTGTCCTGAAAAATGCTG
GCAATGGTGTATGAAACATCTGGGAGAGGATCTGACGGTC
AAATCACACACTCACACACACACACATTTAAATCCAGTTT
CCTAACTATTCTTCAGCTTAACCTCTGTACTATCACTTGC
TCTTAATGCTGTCCTGAAATGAAAAGTGTTTTATTTTATA
TTTGCGTTACAAAAATATATAAAAATATAAGCCATGGCAA
ATAATAAATGGCTGTTCAAATATGTTGGTGTTATTTGTAT
GTTCATGATCATTTTGTGTGTGCGAGGTGAGCTTGTTCGA
TATGCCAGCTTGTCTTAACGCGTTGTACTTTGAATGTAGG
AATCTCTGTCTTGGTTTCTGATTATTGTTGTGGTAAAGAT
GTATTCACAAATCCAGCGGACTACATCTATTGTATTTGTG
GATTTTAACGTATTGTACACAATGTCAGGAGAAGCTGGAG
CTAAATTGGTGCTTTGTTCTATGTTGGTCCACAGATAAAC
ACAAAAACAGTTACTAAATAATAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atg3-201 Contained in:
OTHER atg3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048726 (1)
  • Ensembl_Trans:ENSDART00000041304 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC057434 (1) 1666bp
    GenBank:DN769848 (1) 797bp
    CITATIONS (2)