ZFIN ID: ZDB-TSCRIPT-110325-2665
Transcript Name: bckdhb-202
Previous Name: bckdhb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050937 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050937|OTTDARG00000035755|ZDB-GENE-030124-2 bckdhb|OTTDARP00000040007 bckdhb-001 LG_ CU694364.6 Danio rerio protein_coding KNOWN, 209 bp
ACGGGTTCCAGCGCAATGGCGGCGACGCGGCTCTTCTTAA
GAAGTTCGTGTGTGAAGTCTCGTTTAACGGGGTTCACTGG
CGGAGTGCACGGTAGTTTGAGCTTAACACTGCTCAAACGG
TCGCCGGACTGCACAGCCCAGCCGCGGGCGCAGAGGAGAC
ATGCAGCGCACTTCACATACCAGCCCGACCCGGTGCCCAC
TCAGTACGG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bckdhb-202 Contained in:
[Fosmid] CH1073-438L20 (1) (order this)
OTHER bckdhb-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050937 (1)
  • Ensembl_Trans:ENSDART00000148955 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC129445 (1) 1531bp
    GenBank:CK017450 (1) 852bp
    GenBank:EE719760 (1) 723bp
    CITATIONS (2)