header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2587
Transcript Name: lrrk2-201
Previous Name: lrrk2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050577 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050577|OTTDARG00000035535|ZDB-GENE-071218-6 lrrk2|OTTDARP00000039710 lrrk2-001 LG_ CU855815.10 Danio rerio protein_coding KNOWN, 9170 bp
ATATGATTCATAACGCAGCCTGGACTACACAGGCGCCAAC
ATGACCGAGATTTCTTCCCTAAACCGCAGAGTATCACACC
AGGAACTCAATATTAGTTAGTCAGGACGGCATAAATATGG
CAGAGCCTCTGTGTGAAATCTGCGGGGATGTTAATGTGTC
AACATGGAGGATCAGAAAGTGCCTTTAAGTTCAAGTTTGA
TGTCAGAAACTCGGAGATCATGGCAGAAATAGAGGAGTTG
TCCATCAGACTGAAGAAGCTACTGGTGAGGTTGAATCTTC
AGGATGGGAAGCAGCTGGGGACAATGGTGCAGATCATAGA
GGATCTCCTGTTCCTGTCCCATACTGAGCACTGTGTTGAG
CTGTTTGCGGATCAAAATGTCCATGTGCCTGTGTTGCTGA
AATGCAGCGAAAGCGCCAGCATCAAAGTTCAGCAGGTTGG
CTGGTCTCTGCTGTGTCGGCTGATGGAAATCTGTCCCAAC
ACTCTGGATAATCTGGCCAGACCGGTGGACTATGAATTTA
TAGATGCACACAAGCAGATTCTGAAGGTGCTTCACGAGTA
CCATAATAAAGACGCCAAGATGATGATGGTGGCCCTGAGA
GCTCTGGCTCTGATGCTGAAGTCAGGTGAGATCAAGATGC
AGGTTCTGGATGAGGAGGAATGGGATGTGTTTTACTCGAT
TCTGGAGGCCATGAAGTCATTCAGTGACAGAGAAGAAGTT
CAGCTACAGGGATGTACAGCTTTACAACCACTGCTGCAGA
CAGTTTCTGAGTATCACCTGGCGGAGTTCATCGAGAAGAA
GGACCATGAGGTGGTTTTGAACGCGCTCGGATGCTTTATG
GACAGTGAAAATGTGGTACTTGAAGCTCTGAAGGTCCTCA
TACCACTGGCTGATCCAGCCAGCAATGTTGAGACCCTGAT
GTCCAAAACTGTGAAATGCCATAGTCTAACATGTCGGGCT
ATGAACACGTGGCTGGACTCTGAGGCGATACAGGAGGCTG
GTTGCTGTTTGCTATGGAAATTTACATCAAAGGGTTACTA
TGATATGCTGGTGCTGAACGGTGTCCATAAAGTGGCCGTG
AAGGCATGCGTCTCTTATCCTGACAATGCCACATTGCAGA
CCGCAGCTCTTTCCTGTCTGAGTGCCCTTGCGGAGTGTAT
TGTACAAAATGGAGGACTGGATGAAGAGTGGAATGAGGAG
GACGAGGAGGAACAGAAAGTTCTGGTAAAGAAAGAAGCCG
CTCAGGCGGAGGAGATGCTAATCTGGAGAGAAGCCTGTTA
TACAGCTTTTGAAAGACATGCTGAAGACGTCAAAGTACAG
GAAGCTGCATGCTGGGCTTTAAATAGTTTGCTTCTCCATT
GCAACACATCCAACAATGTGGAACTGGAAGGAAGGCCTCC
TCTTCATACGCTCATCATGGCTGCGATGCTTTTGCACTCA
TCCAGCGTGAAGGTTTTCCAAGCTGCTTCCTCTACACTGC
GCACGCTAATACAGCGCCACTGCAGGATAAGATCTCCACT
ACTCTCAAATGGCATTCATTTCAACATCGTGGAGCTGATG
CGGAAACACCCTAACTCCAGCGCTGTGTGTGAAAGTGCCT
GCAAACTAATTCACACACTCTTCCAGGGAGCGAGGGCCAG
TCTGGACGACGGGTTCCTGATTCTCAGTCAGATCCTCATC
GCTCTGAAGACTCACAACTTCCTTCCTGAAGTTCAGCTGG
AGGGTCTGCGAGCAAGTTTAGTTCTTCTTAATCCAGACAG
GAGTTTGAGAGAGCATGGCGTCTCGGTGGCAGATCCTGAT
ATGGTGGACGTTTCTCTACAGGTGTTGAAGAACCAGTGTG
TCCTAGAGGGAGCTCACACTGTCTATCTGCAAGCACTTAA
TAGGTTTATCAGCAGCGAGTCGATTCAGGAGTGTGGTCTC
GGCGTCCTGGCAGCGCTAGCCGACAGTTCGGGAGCTGTAG
ATCTGATGTGCCAGCAGGGGGCGATAGACACCGTTCTGCA
CACGCTACAGATGTTTCCACAGGAGCGCGATATTCACTAC
TGGGGTCTGAGTCTCCTCTTCCACCTGATCTCTAAGAAGA
AACTGTCTCGTATGATGGTTCCTGTGCTGGCGTCTGTGTT
GGTCAGCTCTGTGCGGAAACACAAAGAGGACTCAGTCATG
CTGCTAAAGGGTCTACAGGTGGTGTGGAAGTTGTTGGACA
CCTGCTCGAGTGCTGCTGTGTGGCTGCAGAAAGAAGCGTT
CGAGAAGGAGATCTTCCAGATCCTGCGGGAGAACACGGCC
GATCAGCGCAGAGATCCGCTGCAGGGAATGAGCTGCCTGT
GCTTGTCTAAGATGGTGACGGATGGAGAGATCCTGTATGC
TCTGCTGGAGAGAGCGTGTGAGGATGGAGACGTGGACATG
GCAGAGTGTCTGATTCAGCTGGGCGCCGACGTCAACAAGA
AAACCAAGAGCGATTCACTCCTATATCAGGCGTGTGATCG
TGGGGCTCCCCTGGCTCTGCTGGAGCTTTTGGTTTCTTCA
GGCGTTCATGAGCAGCATCTGCGTGGAGCTCTGAGTGTGT
GCGTGCGGAGGTCGGATGATCCTGCTGTCACTCTGATCCT
CCGCCGTCTGGGACTTGACCACACCAACAGCGCCCTGTGT
CTCGGCAGCGTCCGCATCGGACACATGAAGGCCTCGTGGA
TCAGCGCTCTTCTGTCTGAGCGCAGGAGTCAATCTACAAA
CACGCACTACAGCAGTAAAGGTCAGCGTTTGGCCAGACAG
ATCTCGCAGCTCCAGAGGAAGAAGGGGATTGTGGGAGTTA
GCAGATTATCGAGTGATGTCAGCACATCAGGATATTTCAC
CGATGAGGAAAGTGACGACTCGCATATTTCCTTAGAGGAC
AGCTTGGTCTTTATGTTCGATGAGTTGGAGAGCGACGGCA
GTGACGGCCCTCCACATGGATTCATGCTAATCAGTGATTC
TCTGGAAGTTAGCAGGAGACCCGTCTGGAGGCGTCGCAGC
CACAGCCGACGTACCAGTTCAGAGGGCTACCATGGAGAGG
CGGATCCAAGTGTCCCTGTGCAGAAGCACGCCAACTCCCA
CAACATCAGAGGTCAGGGTTTCTCTGAGAGTTTCTCCAGT
CCTGTGGTCCTGGATAAAGACCCGGTGCGTCTGCTGGATC
TGTCTGGGAATGAGCTGAACGATCTCTCCTGTCTGACGGA
TCTGAACTCTCTCAAGAAACTGATTGAAAACCTTCATCGG
CTCGATTTGAGCGGCAACAATCTGTCACAGTTTCCCAGCA
TTCTCTGTCAGAGTTTGCGCAGTCTGACTCGTCTGGATCT
GCAGGGAAACCATCTGCAGTGTTTGCCATCTGAACTGCTC
AGTTTACCAGCGCTCCACACACTGAACGTGTCCCGCAACT
GCATCGGTCCGCTCCTGCAGCTGGAGCCCGGCGTCTGCAG
TCCAGCCCTGCGGCGCCTCAACCTGTCCTTCAACCAGATC
ACCGTCTGCCCATTCCAGCTGCGCAGCGCCACCCAGAGGC
TGGAGGAGCTCTCACTGGAGGGAAATCAGATCTCCGAACT
CTCCCTCCCGCTCTGTCTGGCTGAGCTGAAGGTTTTAGAC
GTCAGTAAGAATCAGGTTAAAATAGTTTCAGACAACTTCC
TTGCGGAATGCCTCAAGATGGAAACTTTCATCGCTTCTGT
TAACCAGATCAGTTCACTGCCACACCTTCCCTCCAAAATA
ACCACCGTGAAATTATCACACAACACTTTCACCAGGGTTC
CTGAAATAGTCATCAACTTGCCATGCTTGCGTTCGGTGGA
CATGAGGAATAACAGTGTTGGCGTTCTGCCGGGTCCATCT
GTCTGGCTGAGTGTGAACCTCAGAGAGCTGATGTTCAGCC
ATAATCTCATCTCCGCACTCGACCTCAGCGGCCCTGTGTA
CAAGTGGGCCCGACTGGAGAAACTGCACTTAAGCTTCAAC
AGACTCACTGAGATTCCTCCTCAGATCGGGATGCTGGAGG
ACCTGACGTCTCTGGATGTGAGCCATAATGAGGGTCTGCG
CTCGTTCCCGGATGAGATGGGGAAGCTGGTGCATCTGTGG
GATCTGCCTCTGGATGGCCTGCAGCTCCAGCTGGACCTCA
AACACATCGGGAGCAAAACCAAAGACATCATCAGGTTCCT
GCAGCAGCGTCTGAAGAAGGCCGTCCCGTATCACCGCATG
AAGCTGATGGTGTTGGGGGGCTCCGGCAGCGGAAAGAGCT
CTTTAATTCAGCAGCTGATGAGACTCAGGCGCTCACAATG
GAGATCAGATCCAGGCGTCAGCATTCGGGACTGGCCCGTC
AGGAGCAAAGACAAGAGGAACATGATGCTGAACGTCTGGG
AGTTCTCAGGTGGTGAAGAGTGCAGTGGGATTCACCCTCA
CTTCATGAGCTCCAGAGCTGTCTATCTAGTGCTCTACGAC
CTCAGTAAAGGAGCCAGCGAGATCCACGCCATCAAACCCT
GGCTCTTTAACATTAAGGCTGTAGCGGGTCAATGTCCAGT
GATTGTGGTGGGAACTCATGCAGATTTGTGTGAAGAGCGC
CACCTACAGGAGTGTTTGCTGAAGCTGCAGAAAGAGCTTC
AGTCTCAGCCCGGGTTCCCGGCGATCAGAGAAAACCACGT
GTTGAGTGCCTGCGAGGAGTCCGAGTCACTCGGCCGGCTA
CGCAAAGCCATCTACAGAGAACTCATCGGGTTCAAGATCC
AGGGCCAGCCGGTGATGGGTCAGCTAGTTCCAGACTGTTA
TGTGGAGCTGGAGAAGAGACTCCTGCAGGAGAGATCATGC
GCTCCGGCTGATTTCCCAGTGCTCAGACACAGCAGACTGA
TGGAGATCCTGCAGGAGACGCAGTTACAGCTGGAGGAGGG
GGAGTTACCTCACGCTATACACTTCCTCAGCGAAGCCGGT
GTCTTGCTGCACTTTGATCCAGTTCTTCAGCTGAAGGATC
TGTACTTCATTGACCTACAGTGGTTTTGTAGGATCATCTC
ACAGACGCTGTCTCTGAAAAGCAGCGGTCCATGGGACAGC
ACGAAAGGAGTGGTGCAGCGCTCCACCGTGGAGAAATTTG
TGGAGAAAAGCCGCTGTTTCCCAAAGGATCACATGATTCA
ATACTTCAAACTGTTGGAGAAGTTTCAGATAGCCCTGCCA
TTTGACCATGACCAGCTACTCATTCCTAGCAGTCTGTCAG
ACCACAGGCCAGTGATTGAGCTTCCTCACTGTGAGAATTC
AGAAGTGATCATTCGACTATATGAGATGCCATATTTTCCG
ATGGGCTACTGGCCCAGACAGATCAGCCGTCTGCTGGAAG
TGTCTGCATTCCTGCTCTATGGCAGAGAAAAAGCATTAAA
ACCAAACCGGATCTACTGGAGGAAGGGCATCTATTTGAGC
TGGTCTGCTGAAGCTTACTGTCTGGTTGAGGCTTTGACTT
TAGAAGAAAACCCAGCTAGTTTCATCAAGATCACCGTTCC
ATGCTCTCGCAAAGGCCGTGTGTTGTTTGGGCAGGTGGTG
GACCACATTGACTCTCTGCTGGAGGAATGGTTTCCAGGCC
TTCTCACCACCGACATTCATGGCACTGGAGAGACGCTGCT
GAAGAAATGGGCTCTGTACAGCTTCAGCGATGGACAAAAC
TGCCAGAAGATGCTACTGGAAGACCTGCTCTCCAACACCA
ATGCAGATGGTCTACTGGTGAACCCCGAGGACCCCAGCTG
TACTTTACCCATCTCTCAGATTTCTCCAGACCTGGTACTG
AGTGACCAGCCATCCAGCACCATACTGGACCCAGAGCAGC
TGGAGATGGAGCTCACTGCAGAGTATATGTTGGGGGATGG
AGGTTTTGGCTCGGTTTATAAAGCTGTCTACAAGAATGAA
GAAGTTGCGGTCAAGATTTTTAATAAACATGCGTCTGCGC
TGTACGTTCACCGGCTGGTACGACAGGAACTGGCAGTACT
CGGCAGACTGTGTCATCCTAGTTTGGTGGGTCTTTTGGCT
GCTGGTTGTAACCCACATATACTTGTGATGGAGTTGGCTC
CGTATGGCTCTCTGGACTCGCTGTTTGAGCGTGAAAATGG
CAGCTTAAGTCGCAAATTACAGCACAGGATTGCACTACAT
GTGGCTGATGGTCTCAAATATTTGCACTCATCTATGATCA
TCTACCGAGACCTGAAGCCGCACAACGTTCTGCTGTTCAA
CCTGAAGACGGACGCTGAGATCGTCGCTAAAATCACAGAC
TATGGCATCGCGCAGTACTGCTGCAGCATGGGCGTCCGCA
GCTCTGAAGGAACACCAGGTTTTCGAGCCCCGGAGGTGGC
TCGAGGAAACGTCATCTACAACGTCCAGGCGGATGTTTAT
TCGTTCGGTCTGCTGCTGTATGATCTGTTAACATACGGCG
AGCGCATCTCAGATGGCATGAAGTTTCCCAGTGAGTTCGA
TGAAGTGGCCGTGCAGGGCAAACTACCAGATCCAGTGAAG
GATTACGGCTGTTCTCCATGGCCTGAGATTGAGTCTCTCA
TGAGGGAATGTATGAGAGAAAACCCCCAGGACAGGCCGAC
GTCTGCTCAGGTGTTTGATCGTCTGAACTCTGCAGAGATG
TTGTGTCTGATGCGAGAGCTGAATGTTGTGGGTTTTCCAG
GCGAGTGTTTTGTCGTGTCCAATTCAGGCGGAGCTGCAAA
CGGAGGTAAAAACCCTCATGTGTGGATCGGTGGTGGCAGC
AGCAGCCAGAAACTGGGCTGTGTGACTGCGGTGGATCTGG
AGACCGGCGGGAGTTTGAACCAGGAGCTGGACCGCAGCCC
TATCCTCTGCATGGTGATCATCAGAGCTGCAGACTCGTGC
AGTGACTGGCTAGTGGCTGGTTCAGAGTCCGGTTCGCTCT
TTATCATGGACACCATTAATGCGAAAGTCCTGCACCGTCT
GAAGAGTGTGAAGGACTCTGTGACGTCTCTGTACTTTCAC
ACCGAGCTCCAGCACAGATGTCTGAAGAGTTATCTTTTGG
TGGGCACAGCAGACGGGACACTGGTCATTTATGAAGATTC
AGCCCTGAAGGTGGAGAACGGTGGTCCAGTGAAGACGCTG
GAGGTTGGAGATGTGAACACTCCGCTGATGTGTCTCGGTC
CATCCAGTCATCCTCAGGAGCGCAGATCGCTGTGGGCCGC
CTGTGGGACCAGGATCATCTTATTCACTGTTGAATTTGAC
GTCTGTAGAAGCATTGACACCAAACCCAAACCGCTCTTCT
CACTGCAGGCTCGGGTCAGCGGGGAGGCTTGTATATCACG
GTTAGCGGTGGACAAACACGTGTATGTGAGTAAAACCGGA
GGCCACACTGTTGAGGTCTGGGACAAGAAGACTGAGAGGA
TGGTGAACCTCATCGACTGCATGCAGTTACTCGGATTAAG
TTCCACCAGAAAGCCCAAAGTTCATTCAGAGGACCAGTCT
AGACCGATGGTGCCGTCGTTGGTTGTGAAAGCCTTATTGG
TCCAGCACAGTGGGACTCTGTGGATCGGGACGAGAGCGGG
ACACATTTTGTTGGTGGAGGTTTCCAGTTGTCATCTTTTA
CAGACCATCAACCCTCACTGCCACTCCATACGCTGCATGG
GCTCCATACTTCTAGACACGCTAAACCGAAAGAATGTCAT
TCTAGTATTGGGTAGACGGCAGCGCATACATCTAGAGCAG
CTCAAAACACAATCAGCGGAGGACTCTGTGCTGACGCTCT
GGAGCAGTTCTCTTCCACTGGAGGCTCGAGATCTGATGCG
ACACTGTGAGCTCCGAGACAAAACCACCCGCAGAATGAGA
GAAACGCTGCTTAATTAAACACCATCTCCACACAAAAACA
TCAGAATAAATCCGCCATCGACAACTCCCTGTCAAACTAA
ACAGCATCAGGTGAATTTGTGCACAAAAAACCCCAAGTCC
AGCGTGTAGCTGAGCGTGGAAATGCTTTAAAAAGGGGATG
GTTCACTCAAAAATGAAAACTACGGCATTAATTATTAGTC
ACAAACCTGTTAAACTGACTTTCTTTAGTTGAATAAGAGA
AGTCAATGGTTACAGGTTTTCAGCATTCTTCCAAATATCT
TCTATGTTGTTTTTCATACTATGGAAGTCAATAGTTACAG
CATTTTTCAAAATCTCCTTTCGGGTTCAACAGAAAACAGA
AACTCTTAACAGGTTTGGAACCACTTGAGGGAGAGTAACT
AGACTAATACAATTACTAACTCATAAAAAATGTGCTGAAA
CAACTGAAATTCTCGGGAAAACTTGCTTTTTTACTTGCGT
TTTATGTTCAACACACTAAGTTAATCGATTTGTGTCTGAA
CAACTTGAATGTATGGTAGTTTTGTTTACAGAGTAGCGAG
TACATTTCATTTTCGGGTGAACTGTCCCTTTAAGAGTGTG
TTTAAAATGTCTCCGAGCAGCTTTTAATGCGACCACAGCT
TTACTAGTCACGAAAAGGGACCCGAAATCCATTTCAGCTT
CTTTAAATAGCCAAGGGAAATTTTCATTGTGGTGAATATA
TCATAAATGTAGCTCGTATCTCAGATGTAGCTGTGATTCG
GATTGTATGGAAGCTCATATGAGGACGGAACCAAAACAGC
ACTTGATTATGTTAGCCTTATTATTTTGTAGTATTTATTT
ATTATTGGTTTAAAGCCATGTGAAGAGGAGGCGGCCATAT
ACAATGCATCTGTGATAATGCATTACAGCAGTCATCATTC
TTTCCCCCATTAATGGATGATACATTAATAATGAAAGCAT
TAATGCTGGTTGTGAGATTGTGAATGAAGGCAATGTAATA
TATCACATGATGACATTATATGGTTTGTGGAGACAATCTA
TTGCTGAGACTGGAGCGATTTACGTTAAGCTAATAAACCA
CACTACACAATTTATGATTTATTATAATCATGTTATTTAT
GATGTCCGCAGCGAGCCTTTTTTTTATTATTATTTTTTTT
ATTATTAATTAACTTCATGAAGTTGAGCACAAACATTATA
ACTGGAGCATAAGCCATAGATTAAAAGCTATGATTATGAT
TATTTTGGTTACTGAAATGACCCTTCACTGTTACATTTTT
GTGATTTGTGGGAATGTAATTATTATTATGATTTATAATC
GAATGCTGCATGCCACGTATGTTTTTAATAAAGCTGCCAT
TTTGTATGAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lrrk2-201 Contained in:
OTHER lrrk2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050577 (1)
  • Ensembl_Trans:ENSDART00000148718 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:HM143897 (1) 9171bp
    CITATIONS (2)