header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2423
Transcript Name: ahi1-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049822 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049822|OTTDARG00000035059|ZDB-GENE-060803-1 ahi1|no_translation ahi1-003 LG_none CR407704.10,BX248131.6 Danio rerio protein_coding KNOWN, 545 bp
GTCAAGCCGGACAGCCAATCAGAAGAGCTCCATCCCTCAG
ACAGCAGAAACTTCTCTGTTTGTTTGTTTCTGGCTGTATG
TGGGCGGAGTAATACACAAAGGTGAAGGATGAAAAGGCCT
TTGTTTGATGTTACTGGCGAAATATCACACGGCCATCAGC
CAATCAGATTTAAGAACCAGACAGAACTGTTAGTTTCCAT
GATTATGAATTCTCTCAACAAGTAGAGACAGATTTGGGTC
AAGCTCATCAGACGGTTGTGTCTTTATACGAGTACAGAGC
CAATAGGTCGGACGAGCTGTCGATGCGGCGGGGTGACGTG
GTTCATGTGCTGTATAAAGACAATGACAGCTGGTGGTTTG
GCCGACTGGTCAGTGGGCAGGAGGGATATTTCCCAGCATC
TTATGTGGCTGATGAAGGGAACTTTGATGAGGAGCTGTCA
AGAGCTTTAGAAGCACAACCGTCACTGATAGATCAACCTG
AGGAAGCGGAGCATGCAACACCAGTTCAGATGTCCGCAGC
CATCAGTGCCTCTGGAGAGCTGAAG

ahi1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ahi1-003 545
mRNA ahi1-202 (1) 3955
ahi1-204 (1) 3686
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ahi1-003 Contained in:

OTHER ahi1-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049822 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB909825 (1) 545 bp
    CITATIONS (1)