ZFIN ID: ZDB-TSCRIPT-110325-2418
Transcript Name: mlphb-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes: mlphb (1)
SEQUENCE
OTTDART00000049780 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049780|OTTDARG00000026437|ZDB-GENE-070803-2 mlphb|no_translation mlphb-002 LG_ CR545476.14 Danio rerio protein_coding KNOWN, 627 bp
GCCTATAACTTAACTACAGGACACAGTTTATTCAAATATC
ACACAGAGACTCTCCTGACTCCCTGTAGGTTGAGCAGAAA
GCTGAGGATTTGTCTCCAGCTGATTTAGAGGAGCTTGAGC
TTAGGAAAAAGCTTGATGAACTCACTGAAAAAATAAGCGA
CAAAGGCTTTTCATCTGATGAGGAAGATGCAATTAAATCA
CCAATGGCCTCTCCAAAGAAAAGTGCAGTTTACCAAGTTT
CACCTATAAGAGGAGCTTCAGCTGGACTTGTCCGACCTGA
CTGGCCTCTTGAGGCTGAATGGAAAGCAAAGCCGAATGCA
CACAAATCATTAAAAAAGCAGAAGAGGGTGAGTTCCTTTG
AGTTTAGTAACACAACTAGCTGTGAGCTGTCACAGCTGGA
GGGTAAAGTTGCAATGGCAGCAGCCAGCGTCCAGAGCACT
CAAAGTGGGGTTACAGACATTCAGAAACGAATCGCTGCTT
TGAGTGCAGCAGGGATGACAGTGGAGACATCCCGCAGACG
GGAGGCAGCAATGAAGCAAGATCATTACGGAAGTTGGTCA
CTATGTGAAACAATGACAGAACAATTTCAAAACAATGACA
GATTCACATAATGCATATTTAATGTTC

mlphb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA mlphb-001 (1) 1889
ncRNA mlphb-002 627
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mlphb-002 Contained in:
[BAC] DKEYP-74A11 (1)
OTHER mlphb-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049780 (1)
  • Ensembl_Trans:ENSDART00000139725 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BI889638 (1) 647bp
    CITATIONS (2)