ZFIN ID: ZDB-TSCRIPT-110325-2358
Transcript Name: crb2a-201
Previous Names: crb2-001, crb2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049530 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049530|OTTDARG00000034883|ZDB-GENE-060612-1 crb2a|OTTDARP00000038850 crb2-001 LG_none CU694480.8,CU855942.4 Danio rerio protein_coding KNOWN, 5153 bp
AGAGGAACCTCATCTGATCCACACACACACACCCTCGCGC
TTGCTGGAATTACAGGATCAAGCAGGAATTCGGACATCTG
ATGGTTTTATTTGATGTCTGATCCACTATGAAGTACTCCC
AGAGAGGTTAAAGCTTAAAGGAAGTCGAGTTGGGAATATT
TAGTTTGTTTCACGTCACCATGGAGATCAGGAAAGTGCAT
CTGAAGGGTCCCGGGACGGTTTTACTGACCATGATGATGT
TCAAATGGGGAATATTCTGTTCCGGATCATCTGATTTGTG
TGCATCTTCTCCATGTCAGAATGGGGCAACATGCGTGGAT
ACAATGGACGACTATGTGTGCTTGTGTTCGCGGGAAGGAG
TGCGGTACATGGGGAGGGACTGTGAGGAGCTGTACAATGC
TTGTATGTTTGCTGAATGTGAAGGGTGTGAGAGTGAACTT
GGCACAGACCACTACACCTGTCCAGAGGACAAAGACGAGT
GCAAAAGTGGCCCATGTGTTGGTCCCCACTCTGAGTGTGT
AAATGAGCAGAATGGCTACAAATGCCTGTGCCCACCTGGT
TTCGGGGGAGAAGACTGCAGTCACCGAATCACAGACTGCA
TTGATGAACCCTGCCTCAACAATGGCACCTGTAGACGGAT
AGTGGATGGATTTGAATGTGCCTGTTCTGATGGATTTCGA
GGCGAGACCTGTGAAGAAGACCTAGATGAGTGTGATTCAC
ATCCCTGTCAGAATGGTGCAATCTGTTTGGATGGGGTCAA
CAAGTATCAGTGCTTTTGTGTACCTGGATACCAAGGACAC
AACTGTGAGATTGACATCAATGAGTGTGCATCCCGACCTT
GTTGGAACAATGGGACCTGTATTAATGGGAAAGACAGATA
TCTGTGTGATTGCCTACTGGGATATACAGGTGTAAACTGT
GAGTTGGAAATCGATGAATGCGAGTCAAATCCCTGTCAAA
ACGGAGCCACCTGTCATGACCTAGTGGGACTGTACACCTG
TGACTGTGTGCAGGGATTTGAAGGCTCGGACTGTGAAATT
AATATTGATGAATGTGAAAGTGGTCCTTGCCAGAATGGAG
GACTTTGCCACGACCGCATTGATAGTTATGAGTGTGAATG
TGAAGGCACTGGATATATGGGAGACCACTGTGAAGAGGAT
ATTCCAGAATGTGCATCACATCCTTGCCAACATGGAGGAA
CTTGTCTGGAGGGCATTAACCACTACAACTGTTCCTGTTG
GCCAGGTTTTGAAGGTGGTAACTGTGAGGTGGATATAGAT
GAATGTGCTGATGCTCCATGTGAGAACGATGGTGAATGTT
TTGAAAAGTCAAATCCGGAACACTGGGAAACAGACTGGGA
GTTCACTTATGCCACAGCTGTGGGCTATGTATGTCAGTGC
CAACCAGGATACACAGGAGAGAATTGTTCAGTGAACATAA
ATGAATGTGTGTCCGAGCCATGTCACAATGGTGGAAGCTG
TAAGGATTTGGTTAACGGATACATGTGTGAATGCCCAGAG
GGATTCACAGGTGTGGAATGTGAGGTGAATATAGATGAGT
GTGAGAGTGCCCCCTGCCTTAATGGAGGTGTATGCGAAGA
TGGAGTGGCTGAATACAAGTGTCACTGTGCAGAAGCTGAG
GAAGGTCTGTTGCCATGGGGCGGACCCCAGTGCACGGTGC
AGCTGCTTGGTTGCATTGGACATGAATGCCAAAATGGTGC
CACCTGCTTGCCATGGTTGGATGGAGAGACACATGGACAT
ACCTGTCTTTGTCCACCTGGTTTCTATGATGACGTATGCT
CTATACAAACCACATTCTCCTTTTCCTCACCGAGGTTCTT
TCTTATTGAGCTTCCATCACTTGAACGCAGAAGGAGAGAG
ACAGAACCTGAACACCCCCTAGGGGTCCGCTTGCGATTCC
GCACCACACTGCCTGATATGTTGCTGTTTTTTCGTGGTAA
TGCGGAGTTCTTCCTATCCTTGGAGATTGTTGGGGGTGAG
CTGCGTGCCAGGGCAACATCAAAGGAGGAAGGATCACTGG
AGGCACAATTACCAGGACTTGTAAGTGACGGAGACTGGCA
TGAGGCAATTGTGAACATTAATGAACATGATATCAGGCTT
GTCCTTCAAGTCAAAGGTGCAAACTGTAATAATCAAGCAT
GCAGAGTTGAAGACAAGCTACAAGATGGTCATGAAACTTT
CTTGCACCATGACAGCCTCACCAAAGTGTATGTGGGAGGA
GTACCAGAGGAGTATATTGGGCTTACCTTGAGCGGCCAAG
GCTTTTTGGGTTGTATGGAGGATTTGCAGGTGGATGGTCA
TCCTGTCCTGCCACATGATCTGGGTCATGAGGAGGAGAGC
GTTGAGTTGGGCTGTGTAAAGACAGAATGGTGCCAGGAAG
ATCCACAGCCCTGCTCTCAACAAGGCCATTGTGTTGATCT
CTGGACGAGCTACCGCTGTGACTGTTACAGACCCCATTAT
GGACAGGACTGCAGCAAAGATATGCCTACCTGGACATTTG
GTCATGAGAACTCCACAAGTTTTCTTGCATTTGAACTGCT
GTCTGATTTTGGAAGTAATTTTAGCGTGTCATTCTTCCTT
CGATCCCTTAAATCAAGCGGATTATTATTTCAGCTACGTA
GGTCAGGGGTTCAGGGGACAGAAGATGAACCTTATTTCAC
CATATACCTGGAAATGGGACGATTACAGGTGACCTCTATG
GCGGAGTCACCCATTCTGTCATCACCAGTGTTTGTCTCCA
ATGGAGAAAAGCCACTGCTTCAGGTGGACATACAGGATGG
TCAGGTTTTCTTTAATCATGGAGGATATCGCTACGGGCTT
GGCTTACTGCCCGACTTGGAAGTTCTGGAGGGAGACTTGT
TGTATATTGGTGGAGTTCCAGGTGAAGAGGGTGCAACTGT
TTGGGGTGGTCATTTTAAGGGCTGTCTGCAAGACCTGAGA
CTGGACGACGTGCATCTGGATGTGGAAGACTGGAATAATA
CACTCAGTGAGAGCATCTATATCGCCAGTGATTCAGAAAA
TGTCCTTCCTGGGTGCACGAGTGATGACACTTGCAAGATG
GAGCCTTGCTTAAATGGAGGAGCATGCACAGTCACATGGA
ATGACTTTATTTGTTCCTGTCCAAAGGATTTCACAGGAAA
GACATGTGAAACCAGAGTTTGGTGTGTCAGCGATCCATGC
ATAAATGGTGGACACTGCGTAGATCTGTTGGATGGTTTTG
AATGTATAGCGAACGCAACCTTTGACAATACCCCTTTACA
CTACAGTGCTAAGGGATCTCTACTTGACCCAGTGACCAAT
GTTACCATGAAGCTCCGTACAAGACAGGAAAATGGTGTAC
TACTTCGTGCATGGCGTGGGGAGGAGCTTCTACTGATTGG
TCTGTTGGATTCATCCATTCATGTGGAGATTCACACAGCG
AACAGTGTAGAACCAGTGAAGTTCTCTGGACAGAGACGCA
TAGCAGATGGAAACTGGCATCGACTGCTGTTTGCGATGGC
CCACCCAGAGCATGATGCGTCACAGTGGTTCGTTTTGGTG
GATGGCATCATCGATGGTAGCAGTGCCCCAGTGCTTGCAG
GTAGTTTAAATTTTCTTAAAGACATATCAAGCGAGGTTGC
ACTGGCCGAGACCTTCACAGGATGTCTAGGTGCTGTCAGA
GTGGGTGGAGTTTACCTTCCATTTGTGGACAATACCAAAT
CACCCCAAACAACACGGTTTTGGCGAAGACCAGATGAGCA
TGTACACTTGGGATGCTTTGGGGCACCAGTCTGCCGCTCT
CATCCCTGTAGGCGTGGTGGCACATGTGTGGATCTCTTCA
ATAAATTTGGTTGTAAGTGCCCATCTGGCTGGGAAGGGAA
CATTTGTGAGAAGGAAATAGACGAGTGTATCTCGGGACCT
TGCCTTCATGGCAAGTGCAAGGACAAGCTTAATGGGTTTG
ACTGCTTATGTCACCCAGGATACGCAGGACCTACATGTTC
AGAAAACATAGATGACTGCAAAGGATCGAGGTGTAAGAAT
GGAGGAACCTGTGTTGATGGAGTTAATGACTTTACCTGCA
TCTGCCCACCTAAGTACAGCGGAACACGTTGTCAATACAA
CTACCCACCACTAAAGTGTGCCCTGGATGTTGAATGTGAA
AATGATGGTGTTTGCCATGACACTCCGTGGGGGGCAAACT
GCACCTGTCCTCCAGGATTCACCGGAGAAAGATGTGAGAG
AGAAATCGATGAGTGTGCTTCTAGCCCTTGTCTAAATGGT
GGATCGTGTCTGGATCGCCTCAACCGCTTTCAGTGTTTGT
GTCCCGCAGGATTCAGTGGCCAGTTCTGTGAAACAAATAA
ACAAGCACAGCAAGATCATATACCATGGCTGGCGATAGCG
GTTCCATTGGCTTGTGGCTGTATCCTCTTAGTGGCCATTG
GTCTCATTTTCATGTTAATGACTGCACGAAAGAAGCGGCA
GTCGGAAGGAACTTATTCCCCAAGTCATCAGGAAGTTGCT
GGTGCACGTCTGGAGATGGACAGCATGCTGAAAGTACCAC
CAGAAGAACGGTTAATATGAGATAAAATGCAGAGGCTTTA
ATATTATTGACTTTTCCAAGACGATGTGGCATTATGGAGC
CACAACGAGAACATCAAACAAGCAACCTGAAAGTGCACTG
CGAGAGGAAACTTGAAATTGGAAAATGGGAATGAATTTAA
TATGAATTAACTGTCATTATATGACTGTGGATGTTAACCA
GAAACTCTTCCAGATGACATTGGACTTGGTGATGATTTAC
CTCATGGCATTATATGCCTTAACAGCTCTGACAAAGTGTC
ATACTGTAAAGAGGTGGAAAAAAATTTGTTTACTTTCTCC
CAGCAACAAAACCCTCTCAAAAACGAGCAACTGAAAATAG
TGTTATTGAACAATATTTGAATGTACAAGCTATAATACCC
ATAGCAAGACTGTTGTGCTAACTAGCTACTGTTCCTGCTG
TAGGCTACACTGGATATGATAATCAAAACAGACGAATGTG
GCTTATGGGAAAAATTAGCCATTAACTTTTGCAGAGGAGG
GGTACAACTGAAGTTAGTAACTTCAATAGTAATAATGTGC
TTTCTTTAAAAGAAATATGGGCATTGCTGTTTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
crb2a-201 Contained in:
OTHER crb2a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049530 (1)
  • Ensembl_Trans:ENSDART00000084378 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DQ314736 (1) 5153bp
    GenBank:BC162451 (1) 4628bp
    GenBank:CU638819 (1) 4401bp
    CITATIONS (2)