ZFIN ID: ZDB-TSCRIPT-110325-2251
Transcript Name: npc1-201
Previous Name: npc1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049184 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049184|OTTDARG00000034703|ZDB-GENE-030131-3161 npc1|OTTDARP00000038595 npc1-001 LG_none FP245481.6,FP236166.8 Danio rerio protein_coding KNOWN, 5008 bp
CCGCGGATCTGAGTCAGACGAGCTCTGGAGTCTGAGCCGC
GATGCTTCTGCTGGGGAGAAACCACATTTTCCGTCTTTTA
TTGGCCACAGTTTTATTATCACATTGGGTGCATGGCCAGC
ACTGTATCTGGTACGGCGAATGTGGGAACTCCCCAAACGT
CCCAGAAAAGAAGTTGAACTGCAATTACACCGGTCCTGCT
GTGCCTCTGCCTAATGAAGGACAGGAGCTGCTGCAGGAGC
TGTGTCCGAGACTGGTCTACGCAGACAACAGAGTTTGCTG
CGATACACAACAGCTCAACACACTAAAAAGCAACATCCAG
ATCCCCCTTCAGTACCTGTCCAGGTGTCCAGCATGTTTCT
TCAACTTCATGACCCTGTTCTGCGAGCTCACCTGCAGCCC
CAGACAGAGCCAGTTTATCAGCGTAAAAGACTTCCTTAAA
GAGAAAAACCAGACCAGTGTGGGGAATGTGACCTATTATA
TCACCCAGACCTTTGCCGATGCCATGTTTAACGCCTGCAG
AGATGTCCAGGCTCCATCCAGCAACATCAAAGCTCTCGGT
CTGTTGTGCGGCAGAGACGCCAGTGTGTGTACTCCTCAAA
TTTGGATCCAGTACATGTTTAGTATCAGCAACGGACAGGT
TCCCTTTGGCATCGAACCGATTTTCACAGATGTCCCTGTG
CAGGGCATGACCCCAATGAATAACAGGACGTTTAACTGCT
CTCAGTCTCTGGATGACGGCTCGGAACCCTGCTCGTGTCA
GGACTGCAGTGAAGTGTGCGGGCCCACGCCTGTGCCCCCT
CCCATCCCTCCTCCCTGGATTATCCTCGGCCTGGATGCCA
TGAGCTTCATCATGTGGTGCTCTTACATCGCTTTCCTCCT
CATCTTCTTCGGAGTGGTTCTGGGAGCTTGGTGTTACAGA
AGGAGCGTGGTCACATCTGAATATGGCCCAATTCTTGACA
GCAATCAGCCCCACTCCTTAAACTCTGATGGCACAGATTT
AATAGATGAGGCGTCGTGCTGTGAGACTGTGGGCGAGCGT
TTCGAAAACTCTCTGCGTCTGGTGTTCAGCCGCTGGGGCT
CTCTGTGCGTCCGGCAGCCGCTCACCATCATCTTGAGCAG
TCTGGTGCTGATCTGCATCTGCTCAGCCGGACTCTCCTAC
ATGCGCATCACCACTAACCCTGTGGAGCTCTGGTCTGCTC
CCAGCAGCAGAGCACGGCAGGAGAAAAACTACTTCGACCA
GCACTTCGGGCCCTTCTTCCGCACCGAGCAGCTCATCATC
ACCACTCCATGGACCGAGGAGGGAGGTTTCTCCACCATCA
CAGGAGACATCATTCCCTTCTCCCCCATTCTGAACCTATC
ACTGCTGCATCAGGTGCTGGATCTGCAGTTGGAAATCGAG
AATCTGATCGCTGAATATAAAGGAGAGAATGTGACTCTGA
AAGACATCTGTGTTTCACCTTTGTCTCCTTACAATGACAA
CTGCACCATCCTGAGTGTGTTAAACTACTTCCAGAACAGC
CATGAAGTCCTGGATCATGAGTTTCAAGACGAATTCTTCC
TCTACAATGACTACCACACTCATCTGCTCTACTGTGCCAG
TTCCCCGACCTCTCTGGATGACACGAGCCGTTTGCATGAC
CCCTGCATGGGCACGTTCGGAGGTCCAGTTTTCCCCTGGC
TTGTTCTTGGAGGATATGAGGACTCCGCCTACAACAATGC
CACCGCTCTGGTGATCACTTTTCCTGTCACCAACTACCTG
AATGACACTGAAAAACTAGGCAAAGCTTTGGCATGGGAGA
AAGAGTTTATTAGGTTTATGAAGAATTACGAGAACCCGAA
CCTCACGGTGTCCTTCAGCTCCGAGCGCAGTATCGAGGAC
GAGATTGACCGCGAGAGCAACAGTGATGTTTCCACCATCG
TGATCAGCTACATCATCATGTTTGTCTACATCTCAGTGGC
TTTGGGCCGCATCAACAGCTGCAGGACACTGCTGGTGGAC
TCTAAGATCTCTCTGGGCATCGCTGGGATCCTGATCGTGT
TGAGTTCAGTGGCGTGTTCGCTGGGGATCTTCAGCTACAT
TGGGATCCCGCTCACGCTTATCGTCATTGAGGTCATTCCC
TTCCTCGTACTGGCCGTAGGAGTGGACAACATCTTTATCA
TTGTGCAGACCTATCAGAGAGACGAGCGAATGCCAGAGGA
GGAGCTTCATCAGCAGATTGGCCGAATCCTCGGAGATGTG
GCTCCCAGCATGTTCCTCTCTTCCTTCTCTGAGACCGTGG
CCTTCTTTTTAGGTGCTCTGTCCACCATGCCTGCGGTGAG
GACGTTCTCTCTGTTCGCTGGTCTGGCCATCTTTATCGAC
TTCCTCCTGCAGATCAGCTGCTTTGTGTCTTTATTGGGCC
TCGACATCAAGAGACAAGAGGCCAATCGGATGGATATATT
GTGCTGTGTGAAGTTGTCTGATGGACAAGAAGAAAAATCT
GAAGGTTGGCTCTTCCGCTTCTTCAAGAAAATATACGCTC
CTTTCATCCTGAAGGACTGGGTTCGCCCTCTGGTGGTTGC
TGTGTTTGTGGGAATGCTGTCCTTCAGCATTGCCGTTGTT
AATAAAGTGGAGATTGGACTGGAGCAGACGCTATCCATGC
CTGATGACTCATATGTGCTGAATTACTTTGGGAATCTGAG
CAAGTATCTACACACCGGGCCGCCGGTTTACTTCGTGGTT
GAAGATGGCCATGATTATAAGACGTTTGAGGGCCAGAACG
CAGTGTGTGGTGGAGTCGGCTGCAACAACGACTCTCTGGT
CCAGCAGATTTACACCGCTTCCCTCATGAGCAACTACACA
AGGATCAGTAATGTACCCTCGTCCTGGCTGGATGACTACT
TTGACTGGGTGAAGCCGCAGTCGACCTGCTGCAGATATTA
CAACAGCACAGGAGCTTTCTGTAACGCTTCAGTGGTGGAC
AAGAGCTGCGTTCACTGCAGACCAATGACCTCTAGTGGGA
AACAGAGACCGAACGGCACTGAGTTCATGCACTTCCTCCC
CATGTTTCTCTCTGACAACCCCAATATCAAATGTGGAAAA
GGTGGTCATGCAGCGTACGGCACTGCCGTGGATCTCAAAG
ACAACAACACAGATGTGGGCGCCACATACTTCATGAGTTA
CCACACCATCCTGAAAAACTCCTCCGACTTTATTAATGCC
ATGAAGATGGCCAGAGAGCTTACAGACAACATCACACAGA
CCCTCAGCACGCATGACAAGAGCTACAAAGTCTTCCCTTA
CAGTGTGTTTTACGTCTTCTACGAGCAGTATCTGACCATC
GTCGATGACACCGCGCTGAACCTCGGCGTGTCTCTGTCCG
CCATCTTCATTGTGACGGCAGTTCTGCTGGGCTTTGAGCT
CTGGTCGGCGGTGCTCGTCTGCTTCACCATCGCTATGATC
CTCATCAACATGTTCGGGGTCATGTGGCTCTGGAGCATCA
GCCTCAACGCTGTCTCATTGGTCAACTTGGTCATGAGTTG
TGGGATATCAGTGGAGTTCTGCAGTCATATAGTGAGGGCT
TTCTCCATCAGCACCAGGAGCTCCCGGGTGGAGCGGGCAG
AGGAGGCGTTGGCACATATGGGCAGCTCCGTCTTCAGTGG
AATCACCCTCACCAAGTTTGGCGGGATCCTGATTCTCGCT
CTGTCCAAATCGCAGATCTTCCAGATTTTCTACTTCCGCA
TGTATCTGGCAATCGTGCTTCTGGGAGCCGCTCACGGCCT
CATCTTCCTGCCTGTCTTACTCAGTTATGCAGGCCCGTCT
GTAAATAAAGCAAAGGTTCTAGCTGCGCACAACAGGTTTG
TGGGCACAGAGAGAGAGCGGCTCATCTACTGATCCTCAGC
GGACGACGCCAGCTTTTCATATTCATGTTACACACATTTG
TAACTCATTCAGCTGACAGACTTAACTCAGGACTGTGCTT
TGGATGAACAGAAGACCTTTCTACCACTACTTCTCCTGTC
TGCGTTCACCAAATAAACCTAACACACTTGGTAGATCCTG
ACATGATGCAGTATATAGAGTTTGTGGAGAAGAAAACTTT
TATTTCCATTAAACACAAACCTGTGGTTCTGGTAAAGCAA
CAACGAGAGCATGAGGGCAACGTTTGTTTCGTTTGTATGA
ATGTATACGTGTAAAAAAATGTTTGACTAATCCTTTTTTT
ATTTATTTGTATGCAATTATTTACTTATTGTTAGCATGTT
TCACATAACGAGTCAAATTCACAGATAATGAAAGAACCGT
GTGGACAATCTCTTGATGTATTGTGATGCTTTGACAAGAA
CCGTATGTTACACACAGCTAGCGCTTTATTGCTAGCATGA
CCTGAACGGTGTTGTTTTCAAGCAGGAAAACCACGTTAGT
CTTAGCTAATTAATGAAATTGGTTGCTGTGGGACGTTTTA
AAATTGTTTACTTACAAAGTTGTGCTGCGTTAATTAGCAT
AGACATGCTAATAAAGGGAGTGCTAGCATTAGTTTAGTGA
CTTAAGGCGGCAATTCTAACCAAAACACAAGCAAAGATAG
GTTGCAGTTTGGTTTAACTCTCATATGTTCAGAATTTGCC
TGTTTATTTCAATTACTAACACAGTTTAGCTTTAAAATGG
CTGCTTACATGGTTTTGTAAACCATCAATATGGAAGGGGA
ATTAGCCTACTATAGTAAACTTAGCAACGTGCAAGGCAGA
AATGTGTTTGCATACAAATAAATGGTTATTTTTATGATGA
AAGTTTGGGATTGATAGGAATTGTGGGTATGATGTGATTT
TTCAAAGTAATGTTTGTCATTAGTCAGGGACTGAAAACTT
GGACATTTATGTAAACATTTCCATAGCTTTGGTAAAAGAT
AGATGCGTGTGCCTCATGGACATTATAGCAGTCTAAAGTT
TCTGCTTTGTGCATAAACGTTCTTGATTTGAAGATTTTTT
TTGGAATAAATACGGACTAATTTGTAATAAAAAAGATTGT
TTTATTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
npc1-201 Contained in:
OTHER npc1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049184 (1)
  • Ensembl_Trans:ENSDART00000103596 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090541 (1) 1440bp
    GenBank:EH504588 (1) 900bp
    GenBank:EE304612 (1) 846bp
    GenBank:DN897092 (1) 789bp
    GenBank:DT058729 (1) 774bp
    GenBank:CK237720 (1) 703bp
    GenBank:EB891544 (1) 655bp
    GenBank:BQ419041 (1) 535bp
    GenBank:EB929935 (1) 517bp
    GenBank:AL912905 (1) 458bp
    GenBank:AI722583 (1) 303bp
    CITATIONS (2)