header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2250
Transcript Name: kpnb1-201
Previous Name: kpnb1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049181 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049181|OTTDARG00000034702|ZDB-GENE-030131-2579 kpnb1|OTTDARP00000038594 kpnb1-001 LG_ CU929079.6 Danio rerio protein_coding KNOWN, 3774 bp
CGGGCGGGAGTTCCGCGCGGCCTTTTCCTCGCGACAGCGG
CTGATGAGCAGAAGCGGTAACCGCGAGAACGGCTCGGCGC
TTCAGCATTAGGCGTGGACCGACCGACTTTACCGACCGAC
TGCACTCGTTCTGCCCCCGCGGACCCGACAGGATGGAGCT
GATCACGATCCTCGAGAAGACCGTGTCTCCAGATCGGAAT
GAGCTGGAGGCGGCACAGAAGTTTCTGGAGCAGGCGGCCA
TCGAGAACCTGCCGACCTTCCTGGTGGAGTTGTCCAAGGT
GTTGGCGAACCCGGGGAACACACAGGTGGCTCGCGTCGCC
GCCGGCCTGCAGGTCAAGAACTCTTTGACCTCTAAAGACC
CGGAAGTGAAGAGTCAGTACCAGCAGAGATGGCTGGCTAT
CGACACCAGCGCACGCAGGGAGATCAAGAACTACGTGCTG
CAGACGCTGGGCACAGAGACGTACCGGCCCAGCTCCGCAT
CTCAGTGTGTGGCGGGCATCGCCTGCGCAGAGATCCCAGT
AAACCAGTGGCCGGAGCTGATCCCACAGCTGGTGGCCAAC
GTGACGGACCCCAGCAGCACCGAACACATGAAGGAGTCCA
CGCTGGAGGCCATCGGCTACATCTGCCAGGACATAGACCC
AGAGCACCTGCAGGACAGCGCCAACCAGATCCTGACCGCC
ATCATCCAGGGCATGAGGAAAGAGGAGCCCAGCAACAACG
TCAAGCTGGCCGCCACCAACGCGCTGCTCAACTCGCTGGA
GTTCACCAAAGCCAACTTCGACAAGGAGACGGAGAGACAC
TTCATCATGCAGGTGGTGTGTGAAGCCACGCAGTGTCCAG
ACACCAGGGTGAGAGTAGCTGCGTTACAGAACCTGGTGAA
GATCATGTCCCTGTATTACCAGTACATGGAGACCTACATG
GGTCCTGCACTGTTCGCCATCACGATAGAGGCCATGAAGA
GCGACATCGATGAGGTGGCCCTGCAGGGAATCGAGTTCTG
GTCCAACGTGTGTGATGAGGAGATGGATCTGGCCATTGAG
GCCACGGAGGCCTCAGAGCAGGGCCGACCGCCGGAGCACA
CCAGCAAGTTTTACGCTAAAGGAGCCCTGCAGTACCTGGT
GCCCATCCTGACGCAGACGCTCACTAAACAGGATGAAAAC
GATGACGATGACGACTGGAACCCGTGTAAGGCCGCAGGAG
TGTGTCTGATGCTGCTGGCCACCTGCTGTGAGGATGATGT
GGTGCCGCACGTGCTGCCCTTCATCAAGGAGCACATCAAA
CACCCCGACTGGCGCTACCGCGACGCCTCCGTCATGGCCT
TCGGCTCTATCCTGGAGGGTCCTGAACTCAACCAGCTCAA
ACCACTCGTCATCCAGGCGATGCCCACGCTGATCGAGCTG
ATGAAAGACCCCAGTGTGGTGGTGCGGGACACGACGGCCT
GGACTCTGGGCCGCATCTGTGATCTGCTGCCTGAAGCCGC
CATCAATGAGGTGTATCTGAGCCCGCTGCTGCAGTGCCTG
ATCGAGGGGCTGGGGGCCGAACCACGCGTCGCCTCCAACG
TCTGCTGGGCTTTCTCCAGTCTGGCTGAGGCGGCGTATGA
GGCCACAGATGTGGCGGATGATCAGGAGGAGCCGAGCACT
TACTGCTTGTCCTCCTCCTTCGAGCTGATCGTGCAGAAGC
TGCTGGAGACCACCGACAGGCCGGACGGGCACCAGAATAA
CCTGCGCAGCGCGGCGTACGAGGCTCTGATGGAGATCGTG
AAGAACAGCGCGAAGGATTGTTACCCGGCGGTGCAGAAGA
CCACGCTGGTCATCATGGAGCGGCTGCAGCAGGTCCTGCA
AATGGAGTCTCACATCCAGAGCACATCAGACCGAATCCAG
TTCAATGACCTCCAGTCTCTGCTGTGCGCCACGCTACAGA
ACGTGCTGAGGAAGGTGCAGCATCAGGATGCGCTGCAGAT
CTCGGATGTGGTGATGGCGTCGCTGCTGCGCATGTTTCAG
AGCACCGCCGGCTCCGGAGGCGTGCAGGAGGACGCACTGA
TGGCCGTCAGCACACTGGTGGAGGTTTTGGGCAGTGACTT
CCTGAAGTACATGGACGCCTTCAAGCCTTTCCTGATTATC
GGACTGAAGAATTATGCAGAATATCAGGTCTGCCTGGCTG
CGGTGGGACTGGTGTGTGATCTGTGTCGGGCTCTGATGGC
CAATATTCTGCCTTACTGTGATGAAATCATGCAGCTGCTG
CTGGAGAATCTGGGTAATGAGAATGTGCACCGCTCCGTCA
AGCCCCAGATTCTGTCTGTGTTTGGAGACATCGCTCTCGC
CATTGGAGGAGAATTCAAGAAGTACCTGGACATTGTGCTG
GACACTCTGCAGCAGGCCTCGCAGGCACAGGTGGACAAGA
CGGACTATGATATGGTGGATTACCTGAACGAGCTGCGTGA
GGGCTGTCTGGAGGCCTACACCGGCATCATCCAGGGCCTG
AAGGGGGACCAGGAGAATGTGCACCCCGATGTGATGCTGG
TTCAGCCGCGTGTGGAGTTCATCTTGTCCTTCATTCACCA
CATCGCAGAGGACGAGGACCGATCTGACGGAGTCGTGGCT
AATGCTGTAGGGCTCATCGGGGACCTGTGCACCACCTTCG
GGAAGGATGTGATGAAGCTGGTGGAGGTGCGTCCTCAGAT
CAATGACCTGCTGACTGAAGGCCGGAGATCCAAAACCAGC
AAAACCAAGACTCTGGCCACGTGGGCCGCCAAGGAGCTGC
GCAAGCTGAAGAGCCAAGCCTGATCTCCGGCTGTGGAGTT
TCTTCTTCTTCTTCTACCAGGACAAATGGAAATGAAAGCC
CTGCGGTTCTTCTGTCTTTTAGAGCTGTGGACAGAAGTGC
TTGTGCGCTGATGAGTGTGTGTGCGAGTGTGAGAGCGAGT
GTAAGAGCGAGAGATTGACACACACCTTCAGTCCAGCTCC
AGCAGAGGAACAGCGGCACACACCTCCACCTTCTCCACCT
GCCCGCGTTCTCCATCCTGACCCGATCCTCCCCCCGGCCC
GATCAGCTGCAGGACTGACCGTCACACACTGATTAGCAGA
CGGCGGCCGCGGGAACCTGCTGCTGGAGCCATGATGGCGT
GACTGGAGTGTGTGTGTGTGAGTGAGCGAGGGCGGCGCTG
TTTCCGCGTCGTCTCTCAATATTTCAACCAATAATAAATA
AAGGTGATCAATATCTTGTTTGCGATTGAGTGAGCTGCTC
TTGCGTTCCCTCGGCGAGCGGCAGTGGAGGCGTCCGGCCT
CTCGTCACGGCTGCGCTACATTACTGGCCTCCTCCTCCTC
CTCCTCCTCCTCTGTGTTTCTTTAATAATAGTGCTGATTG
AGTAATGGTTCTCTTACCGGTGTGTGTTAGTATGGATGTG
CGGATCGGAGCTTCACCTGCCCTGCCTAGGGAAGACTATT
GCCACTACAGGCGCAGGCTCCGGCGGAGCGACGGGATATT
AGACACCTCCACACGCGACTTTATTCTCCTTTATTTGTTT
TGCAGGAAACTGAGTGCCAAACCCAGCGGTGCAGATGGAC
TTGAGCTTAATGTGTTACTCGTAGAAGATGCGAATTAATA
ATACACACGTCAGCGGCGGCGAGCCGAGCAGCATCCATGT
GCTTTTGGTTGTAATTTTTTGTTTTGTTTTCCTCTTGCGG
CACTTAATTGGAGTCATTCACCGAGCTTTTAAGAAGACGA
CGACGGACAGAATCAGACATTTGTATGAGGTTATATTTTT
CCATTGATATGAAA

kpnb1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA kpnb1-002 (1) 974
mRNA kpnb1-201 3774
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kpnb1-201 Contained in:
[Fosmid] CH1073-205C8 (1) (order this)
OTHER kpnb1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049181 (1)
  • Ensembl_Trans:ENSDART00000163823 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE330297 (1) 900bp
    GenBank:CT626739 (1) 789bp
    GenBank:GO935609 (1) 777bp
    GenBank:DY547886 (1) 755bp
    GenBank:DY561246 (1) 719bp
    GenBank:EX155562 (1) 700bp
    GenBank:AI958061 (1) 655bp
    CITATIONS (2)