Transcript

rnf150b-201

ID
ZDB-TSCRIPT-110325-216
Name
rnf150b-201
Previous Names
  • rnf150b-001
  • ch211-149b19.1-001
  • ottdart00000048283
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048283 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048283|OTTDARG00000034181|ZDB-GENE-050417-470 rnf150b|OTTDARP00000037888 CH211-149B19.1-001 LG_ CR318612.25 Danio rerio protein_coding KNOWN, 4240 bp
GTTTTTATCTCCAACAGCTGAAGGCCGAAAACATCCGACA
CCATGGCTCCGTCGCGACGCTCCTGCTCGCGTTTTTACCG
ACCCACACGCTAAACAGGCGGTAGGGTTTATTAATCAAAG
TATTCACTCTATTACCTGTAGTTTTTACAAACGGTTTACT
CATGAGTGACTGCTGCCGCTCCGCGTAACGCGCACAAAGC
GGAGATTATGGAGTGAACGCGCGTCGAGCGGCCGTTAAAC
CGTCATAACAATAACAATAAACCCGTTATGGCGCTGTCTG
TGATTCAGGCGTGTCGGAGTCTGGCTCTGTCCACCTGGTT
GCTGTCTTTCTGCTTCGTTCATCTGCTGTGTTTGGACTTT
ACGGTGGCCGAGAAGGAGGAATGGTACACGGCGTTCGTTA
ACATCACATACGTGGATCCGGACACGGCCGAGGTCCGGAC
CGAGAAAACGGAGTGCGGGCGATACGGGGAGCATTCACTC
AAACGGGAGGCCAGAGGCGTGCTTGCGATGCCCGCCGCAC
CGCACGACAGACATGCATGCGACCCGAGCGGCAGATTCAC
GCCGCGCGCACACGGTGCCTGGATCGCGCTCATCAGCCGC
GGAAACTGCACGTACAAGGATAAAATCAGACACGCCGTGG
GACACAACGCGTCAGCCGTGGTCATATTCAATGTGGGCTC
CTCTAACCCCAATGAGACCATCACCATGCCGCATCAAGGC
ATCAGTGACGTGGTGGCCATCATGATCCCGGAGCCCAAGG
GCCGAGAGCTGGTGCTGCTGATGGAGAGGAACATCACGGT
CCACATGCACATCACCATCGGCACACGAAACCTGCAGAAG
TACGTCAGCCGCACATCGGTGGTGTTCGTCTCCATCTCCT
TCATCATCCTCATGATCATCTCGCTGGCCTGGCTCGTCTT
CTACTACATCCAGAGGTTCAGATACGCCAACGCCAGAGAT
CGCAACCAGAGGAGGCTTGGAGACGCTGCCAAAAAGGCCA
TCAGCCAATTACAAGTGCGCACCATCAGGAAAGGAGACCA
GGAAACGGAGAGTGACTTTGATAACTGTGCTGTTTGTATC
GAGGGCTACAAACCTAATGATGTTGTCCGAATTTTGCCCT
GCAGGCATCTGTTTCATAAATGCTGCGTGGACCCGTGGCT
GGTGGACCACCGGACGTGTCCCATGTGTAAAATGAACATC
CTCAAAGCCCTCGGCCTCACGTCGAGTGCCGAGTGTCTGA
ACGAGCTCCCCTTGGACTATGAGCTGGCCGTTGGGGGCGT
GGCTCTCAACGCAATGGTGATGAGTGATGATGTCATGGCA
GGGGATGTGGGCGGTGCCCGTGATCCCGGGGTCAGGATGG
GGGGTCTCCCTCAGGTCCTCCTCGACTCAGAGCCTCTGTC
GCAGGACACGATGCCAACTGAACAGAGTGAGTTACAGCCA
ATAGCCAGTGGGAGTTCAGATGTCTCCCTGACGACAGGGG
CAGGGCATTCAGATATTGACACGCCCACTGATGACCCAAA
GTGCTGATCTGGCCACGCCCATAGATCAATAGTTTGTCTG
AGCGCAGCGACGGGCTGGAAAGAGCTTTAACCTCAGTGGA
AGTCTGGCCGATGTCTCGCGGTTTAACAAACACACTGCCT
GTTACTTTCATTCCTCTCTCTCTCTCTCTCTCTCTCTCTT
TCTCTGAAAAGCAGGGTGAACTCTCTTCTTTCTCCCCTTA
AGTGTGCACACTACAGTACACACTACAGTTACATACTTGA
GCTAAAGCACTTGGCGGACGTTCGACAATCAGATCATATC
TCTATCTCTTTCCTACCGTCGCAGTGTTGTTCGCTGCCTG
TTTTACCACTGTCTGTGATCCCGGCGCAGCGCAAAACAAA
AAACAAGGTGTTAAAGACTATTTTGAATCCCAAAAGATGT
GGTTTATTTTTTTATAGAGGAGCGTTTTGATGTGCTTGAG
TTCTGCAGTATTAAATACAAACAAAAAAAGAGAGAGAGAG
ACTGTGTCAGTATTTAGACGCCTTCCTTTTGGAGATGTTT
TTTTTGTGGGATTTGGCCCTCACCAAAGACGCCTGGACGG
ACGTTGTGCGGGACAAAACTGTGGGACTTTCTAGGAAGTG
CTCTTTGGATTGTGTGGAGCAGGTCATGTGATGTTTGCTG
TGCATGCCACATGCCCGATCCACCTGTGCTTTCAGTGGAG
TTCCTTCAAAGGGATAGTTTACTCTCAAAACAACATTATT
TACTCAGCCTTGTGTCATTCAGATCCCTTTATTTAAAACA
AAAAAAGGTCAACACACTGTAAATAGCGATTAGGTATTTT
ACTTACTTTAATAAAGTGAGTAAATCTGTTGCTTTTAAAG
CGGTTAGTTGACTTTACTTTAATAAAGTGAGTAAATCTGT
TGCTTTTAAAGCGATTAGTTGACTTTACTTTAATAAAGTA
AGTAAACCTGTTGCTTTAAAAGTGATTAGTTGACTTTACT
TTAATAAAGTGAGTAAACCTGTTGCTTTTAAAGCGATTAG
TTGACTTTACTTTAATAAAGTGAGTAAATCTGTTGCTTTT
AAAGCGATTAGTTGACTTTACTTTAATAAAGTGAGTAAAC
CTGTTGCTTTTAAAACGGTTAGTTGACTTTACTTTAATAA
AGTGAGTAAACCTGTTGCTTTAAAAGCGATTAGTTGACTT
TACTTTAATAAAGTGAGTAAACCTGTTGCTTTTAAAGCGA
TTAGTTGACTTTACTTTAATAAAGTGAGTAAACCTGTTGC
TTTTAAAGCGATTAGTTGACTTTACTTTAATAAAGTAAGT
AAACCTGTTGCTTTAAAAGTGATTAGTTGACTTTACTTTA
ATAAAGTGAGTAAACCTGTTGCTTTTAAAGCGATTAGTTG
ACTTTACTTTAATAAAGTGAGTAAACCTGTTGCTTTTAAA
GCGATTAGTTGAATTTACTTTAATAAAGTGAGTAAACCTG
TTGCTTTAAAAGTGATTAGTTGACTTTACTTTAAATAAAG
TGAGTAAACCTGTTGCTTTTAAAGCGATTAGTTGACTTTA
CTTTAATAAAGTGAGTAAATCTGTTGCTTTTAAAGCGATT
AGTTGACTTTACTTTAATAAAGTGAGTAAACCTGTTGCTT
TTAAAGCGATTAGTTGACTTTACTTTAATAAAGTGAGTAA
ATCTGTTGCTTTTAAAGCGATTAGTTGACTTTACTTTAAT
AAAGTAAGTAAACCTGTTGCTTTAAAAGTGATTAGTTGAC
TTTACTTTAATAAAGTGAGTAAACCTGTTGCTTTTAAAGC
GATTAGTTGACTTTACTTTAATAAAGTGAGTAAATCTGTT
GCTTTTAAAGCGATTAGTTGACTTTACTTTAATAAAGTGA
GTAAACCTATTGCTTTTAAAACGGTTAGTTGACTTTACTT
TAATAAAGTGAGTAAACCTGTTGCTTTAAAAGCGATTAGT
TGACTTTACTTTAATAAAGTGAGTAAACCTGTTGCTTTTA
AAGCGATTAGTTGACTTTACTTTAATAAAGTGAGTAAACC
TGTTGCTTTTAAAGCGATTAGTTGACTTTACTTTAATAAA
GTAAGTAAACCTGTTGCTTTAAAAGCGATTAGTTGACTTT
ACTTTAATAAAGTGAGTAAACCTGTTGCTTTAAAAGCGAT
TAGTTGACTTTACTTTAATAAAGTGAGTAAACCTGTTGCT
TTAAAAGCGATTAGTTGACTTTACTTTAATAAAGTGAGTA
AACATGTTGCTTTAAAAGCGATTAGTTGACTTTACTTTAA
TAAAGTGAGTAAACCTGTTGCTTTTAAAGCGATTAGTTGA
CTTTACTTTAATAAAGTGAGTAAACCTGTTGCTTTAAAAG
CGATTAGTTGACTTTACTTTAATAAAGTGAGTAAACCTGT
TGCTTTAAAAGCGATTAGTTGACTTTACTTTAATAAAGTG
AGTAAATCTGTTGCTTTTAAAGCGGTTAGTTGACTTTACT
TTAATAAAGTGAGTAAACCTGTTGCTTTAAAAGCGATTAG
TTGACTTTACTTTAATAAAGTGAGTAAACCTGTTGCTTTA
AAAGCGATTAGTTGACTTTACTTTAATAAAGTGAGTAAAC
CTGTTGCTTTAAAAGCGATTAGTTGACTTTACTTTAATAA
AGTGAGTAAACCTGTTGCTTTAAAAGCGATTAGTTGACTT
TACTTTAATAAAGCGAGTAAACCTGTTGCTTTTAAAGCGA
TTAGTTGACTTTACTTTAATAAAGTGAGTAAACCTGTTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations