header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1983
Transcript Name: rabggta-002
Previous Names: ch73-212e20.2-002, zgc:153107-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048084 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048084|OTTDARG00000034070|ZDB-GENE-060929-1042 rabggta|no_translation CH73-212E20.2-002 LG_ CU693481.9 Danio rerio protein_coding KNOWN, 881 bp
GTGTGCGTGTCTGTGTGTGTGTCTGTCTGATTGTTTCTCT
ATAGTGTGTGTGTATCAATATGTGTGTTTCTGTGTTTATA
TGTGCGTGTATATGTCTCTCTCAAATGTTTCTGTGTGCGT
GCAGGAGTGAGCTGTCAGTAGAGAAGAGTTCAGTTCTTCA
GGCTGAGCTTCAGTCCTGCAATCAGCTGCTGGATCTCGAA
CCTCAGAACAAATGGTGTCTGCTGACCATCATCCTCCTGA
TGAGAGCTCTGGATCCTCTGGGCCATGAGAAAGAGACTCT
GACCCATTTTCAAACCCTTAAAGAAGTGGATGCGATGCGC
TCCTCCTACTACAGTGACCTGTGCAGTAAGTTTTTGATTG
AAAACACCATCCTGAAAATGGAGTATGCAGAGGTGCGCGT
CTTCAGCCTCTCCAATAAGAAACTGACCACCTTGTGTCAC
CTGGATCAGCTTCTGCTGGTCACACACATCAACCTGTCGT
CCAATCAGCTGCAGCATCTGCCGCCTCAGTTCAGCATGCT
ACAGTGTCTGGAGGTGCTGGAGGCTGATGATAACGCCATC
GAAAGTCTGGAGGGTCTCTATCATCTGCCTAAGCTAGAGG
AAGTTTCTCTGAAGAACAACAAAATCTGCAAAGTGTCTGA
TCTGGAAACACTGGCGACCTGCACCAAACTGACCAGACTG
GACCTGCGTGGAAACCCTGTCCACAAAACTGACGACCTGG
AGTCTGAGCTCAGCCTGATCCTGCCATTGGTCACTGCCCT
GTCTCTCTGATATGTGTGTGTGTGTACTTGTTTTTATCTC
CCAGTGGGGACTTAAACCTGAATGCACACAGACTTATGGG
GACTTGTGTCACTGCGGGCACCAGAATTGATGGGTTAACA
T

rabggta TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rabggta-002 881
mRNA rabggta-201 (1) 2995
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rabggta-002 Contained in:

OTHER rabggta-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048084 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN017398 (1) 883bp
    CITATIONS (1)