header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1916
Transcript Name: cdcp1a-201
Previous Names: cdcp1a-001, dkey-288i20.4-001, zgc:113071-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047872 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047872|OTTDARG00000033943|ZDB-GENE-050327-55 cdcp1a|OTTDARP00000037574 DKEY-288I20.4-001 LG_ CU467885.10 Danio rerio protein_coding KNOWN, 2614 bp
CTGGAAGTCGCGAAAACCAGGAAGAAGCTGCTTTATCTCC
TCTGAGGAAAACTCGCGTCCATGGCGGACTCTTTATTACA
CCTCTTTAACCTACTGTAAGGAGTTTACTGGATATTTAAA
AAGCCATGCGAAGTTGGCGTGTGACCTGCTTTTCGCTTGT
TTTGCTGGTGTTTTTCCTCTCGTCAGTCCTGGAGCTCACA
GGTGGAGCTGAGCTCAACGTTGCTGTTGAACAGGGCACAA
CCATCCTCATCAACACAAGTTCCAGCACAAGCACACAGTG
TAAAGTGTGTATGAGAGTGCGAAACCAGCCCTTGTGCCAG
GCTTATGTGGTCCTCAGAAGTGATACGCTTTTGGATTTCA
GCTGTTCGCAGCCAGAGAAAGTGTTTATTGTGCAGATCAT
CAGAGACACGGGGACAATGAACATTGAACCCAAAGATCAC
AGTGCTTTTATAAAGTTTAATCGCACGTTCACCTGGAATC
TGAAGCCTTTAGTTTCAAAATCCCTCCAGTTGAATTTCAG
TAGCACGGGTTTACGACAGATTGAGCCTGAGGACAGCTGT
CCTGACAATCACAGATACATACTCGCGGTGGAGAACATCA
GCATCGGGACATTTTGTCAGAATGGAGTCATCAGACAAAT
TGACGTGCGTAATGCTGGAAAACTGTCTGCGGAAGTGACT
GGAGGTCAGAGTCTAAGCATGAAAGTCATCGCTGTATCAG
TGGGACGTTTAATGAACTCTCTGGTTAACATCCATGCTGT
TCTCCCAGAGAAGAGCTCAATCCAGGACTTCATAACACCA
AACACAACCCCTGAAAATGCAGAGATCATGTGGTTTTTCA
GCATGCCCAATGCATACTATGCAGACGTACGCATTCTGAA
GTACACTCTTCCAACATGCCTGTCGTCTGAAAGCATCCCT
ACAATGAAGTACACCTGGCAGGGCAGGGATGCTCTGGTCA
AGCGTATGAATGAAAACCAGCCGTCAGTGGAGCCTGGAAA
CTTTAACATCTCCATAAAGAACTGCAAAATGTCCACGGTG
TCTTCATTGAACAGATTGATGGTGCACTTTCAGATCTCTG
CCATCAAGAGAAGGAAGGGCCAGTGTGAAGGAGATCTGCC
AGACAAGCAAGTACTGAAGATACAAGTAATGAAAAAGGAT
CCCAAGTCGGTCTGTGTGTTGAAACTGGATTCGGTCATAA
TGGACACAGTCACCATCGCTTCAGGGAACCATTTTATTCT
TAATACCTTTGACTGCAACAAGGATGAGCTGGAGTTAACT
GTAATCCAGACTGAGGAATGTAAAGAATGGAGGAACTGTA
CATCCACTCTGTTCCCGCTTCACTTCAATTATGAGCAGCA
GTGTATCCCAGGAGTCCTGAAGATGATCACGTGGTACATT
CAGGGTCCAGTCAACAGTGCAGTGGAGCTACAGTCTCCTA
CAGACGGCCTGCGCTACTGTTTGCCTGAAGACAATTGCAA
CAGCATCCTACTGCTAAACGTCTCCCAGGTTATGAACCCA
GGCACCACTGTTGGCCAGTTCTGTCCAAAGGGATCCGTTC
AGAAGATACAGATCCGGGAGTCCAAGATTGCAGTAACTGC
TTCTGTTACAAGTTTCAGCGACCGGAGTGTGGCAGCAAAA
CCAATCTTAAGCTATTCGTTCACACAAGGCATATCGGAAA
ACTACATATTCAGTGTCACACCAAAGATGGATAATCCTAC
CACGCTGGCGACCCCAGGCTGGCCGTCTGCAATGAAAGCG
TCCAGCACAGTGTCCTGGATAGTGAACATGGAGCCGCAGT
ATACAAGCGTGCTGACATTCAGAAATGTCAGTCAGCCCAA
GTGTAAACAAGTGCACACAAACATCGCAGTGCAGACCATT
CGCTCTCAAACGGTGCTGTACACCACTACAAAAGATGATA
AGATGAAGGATCTCCTGCTGCCAGAAGGTTTTTACCTCAA
CATGACGAACTGCAAGTCACCGACAGGAGCCTTCAGGGCA
ATGATGGAGGTCACGGTGCAGAGCAACACAAACAAGCTTC
TGGGCATCATCCTGGGCGTTGTGGGCGTTGTGTTGGCCAT
CGCAGTAGCTGTGGTAATCTGGTTTGTTCTCAGGAAAAAG
AAGAGGAATAAGGCTCCCCCGGTGTCCGTGTACAACCCCA
GTGAGCACGCCTTCCTTCCAGGCTTACATGGCATCCCGAA
AACACAAGAGGAGGATGAGGAGAACCACACGTACGCATAC
ATAGATGACACTCTGGTGTACAGCCATCTGCTTAACGATG
ACGCTGACAATAAACAGCATTATGAAGACACCTCCGGCCC
ACATCTGAATAAACCGCCGTTACCGGACAGACCAGACAGA
AACGTGGACAGTCACGCTCTAGACAAAGCATTGCTTCCCA
ATGAGCTGTACGGGTATGTGCAGGGGCAGTCAACTACATC
TGGACCAACAAGAACATCAGGCAAAAGCTCTGAGGAGCAC
ACCTATGAAACCAGACTCTGTGTGTGACCGAGAGCTTTAT
GAAGACGTTTGACGTTTAGCGATGTTTTGCGTGAGCAGAT
TGCTTTTTTTTTTTAAAAATGACTGCATGCTTTTGATATT
AAAATGTCTGTTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdcp1a-201 Contained in:

OTHER cdcp1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047872 (1)
  • Ensembl_Trans:ENSDART00000148543 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC091838 (1) 2624 bp
    GenBank:BC164573 (1) 2449 bp
    GenBank:EE330268 (1) 770 bp
    GenBank:DY546430 (1) 710 bp
    GenBank:CK686977 (1) 596 bp
    GenBank:EH561575 (1) 516 bp
    CITATIONS (2)