header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1915
Transcript Name: acot22-201
Previous Names: dkey-288i20.1-001, si:dkey-288i20.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047869 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047869|OTTDARG00000033940|ZDB-GENE-110407-17 si:dkey-288i20.1|OTTDARP00000037571 DKEY-288I20.1-001 LG_ CU467885.10 Danio rerio protein_coding NOVEL, 1837 bp
TCCTGCAGTGATCACAGGGATAACATGTATGCAGCACTGA
AATTTGCCTTTATGCCTTTTGCAAGATCCCTTGCGAAGGT
GCACTACAGTTCAGGAGTCAGCATCAAGCTTCTGCCCAGT
TACAAGTGCTCATTCGAAGACCCGGTGCATGTGATGGTGA
GCGGCTTAAATCCACATCAACGTGTGAATCTGCGCTCCAA
AATCACGGATGAAGGTGGACGTGATTTCAAGGCTTCAGCG
ATCTACCTAGCAGATGACAATGGCCAAATTGACCTCAAGC
GCGACTCTTCTGCTGGCGGGAGCTTTTCTGGAGTGGAACC
GATGGGTTTATTCTGGGCTCTGAAAGCAGATCTATTAAGC
TGCAAGTTCAAGCTGAAAGATGTGACGCGTCCAGCTCTTG
TTGACATTGAGGTTGTCGGTGAGGATGAGAAAGTCCTGGC
CAAAGTGACCAACGAGAGACACTGCCTGAGCGAGGGTGTC
CGGAGAAGTCTTGTCACCGAAGGAAGGATCAGAGGGACTC
TTTTTATGCCCACTGGTAATGGACCATTTCCTGGGATTTT
GGATACTTACATACTTAAAGGAGGTCCTTTTGAGTTGAGA
GCAGCTCTGCTGGCAAAGAGAGGCTTTGCAGTTTTAGCCT
TGGCCTACCAAAACTACCAGGATTTACCCAAAAAAGCTGA
CAAATTTCACCTGGAGTACTTTGAAGAAGGTCTAGATTTC
CTACGCCGACAGCCAGAGGTGAAAGGTCAAAAAATCGGCC
TTCTGTCCATATCAAAGAGTGGAGATCTCGCTTTGTCCAT
GTCAACGTTTCTGCCGGACATAACAGCTGCTGTTTGGATC
AACGGATGCAATGCCAACAGCCTGATCCCGCTCTACTACA
AAGACATGTACATTCCACCTCTCACGCTTGACTTTAAGAA
AAAGAAAATGACAGCATTAGGCCTCGTAGACATGCTAGAG
GTTGTGAATGACCCGATGTCTAAAGAAGGTCTTCCTACTG
TTATTCCCATCGAGCGTGCCTCTGCTAGTTTCATGTTCAT
CGCTTCAGAAGCTGACATGAACTGGCGGAGCGTCTATCAT
GCAAAGTTAGCATGCGACAGGCTCAAAGCACATGGGAAAA
ACAACTATGAGCTGGTGAAGTATGAAAAAGCTGGTCACTT
TATCGAGGTGCCCTACATGCCATTTTGTCTGGCTGCATTT
CATGGCGTACTTGAGCAACCGGTTTTGTTTGGCGGGGAAC
CCAAAGCTCATTCAGAGGCACAGGTGGATGCCTGGCAAAG
GATTATCATATTCTTTAAAAGAACCCTCGGCAGCTGAGCT
GTAAGGGAATATACACTATAGCCATGACATCCAATTATAG
TGCTGGCCTGAATTACATCTCTTTATATTTTTAGCACTGA
TTATATTCAGTGCTAAAAATATAATCACACCAGTAATGTT
TTGCTCTTAAGTTTACTGATGCCTACATATTAAAATGATT
TCTGCAAAATTGTTACAAACAAAATCCATATGGGATGAAT
TTAAACATTCATTTATTTTCCTTCAGCCTAGTCTCTTTAT
TAATTAGGGGTCACCACAGCGGAAACAACCGCCAACTTAT
CCAGCAAAAGTTTTATGTAACAGTACTGGGAAACACCCAT
ACACTCTCACTCAGTTTAGATTTTAGATTTTATATTTTAC
AGTTTAATAAAATAAAATAAAATGAATAAAATAAGCTGAT
TATTTTTTTTATTTTATGTTTAGGTCAATTACAGCTTCTG
AGTTGTGTTTGTTAAAGTCATAAGTGTCTTGCAGTGCTGC
TTCTGCAATAAACGGTGAGCAAATTACCTTTCAACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
acot22-201 Contained in:

OTHER acot22-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047869 (1)
  • Ensembl_Trans:ENSDART00000081918 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC074051 (1) 1845 bp
    GenBank:EE327666 (1) 879 bp
    GenBank:DT064401 (1) 763 bp
    CITATIONS (2)