header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1817
Transcript Name: mapk1-201
Previous Name: mapk1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018990 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018990|OTTDARG00000015839|ZDB-GENE-030722-2 mapk1|OTTDARP00000016029 mapk1-001 LG_ BX005237.6 Danio rerio protein_coding KNOWN, 1641 bp
AGTCAGTCAGTCGGTGAGTCGGTGCTCGGAGCCACGCGCA
CGTTAATTTACTATCAGCAGAAAATATATGCCTGTCAACA
GCATTTCAGCCGCTGCTCTCCAACACCGAGTCTTCGGTTC
AGTTTAAAAGCGTCGCTTTTCGCCGTGTTTCACTCTACCT
AAGAGCTTTTCCTGGTGCTTTTGGGTGAGAAAAGCGCGTT
TGTTTTGCTTGTGAAGGCAGCTTCAGTTTCTCAGCAATGG
CGACAGCTGCGGTTTCTGCCCCTGCTGGCGGCGGCCCGAA
CCCCGGATCCGGTGCCGAGATGGTCCGCGGGCAGGCTTTC
GATGTCGGGCCGCGTTACAGCAACCTCTCCTACATCGGAG
AAGGCGCTTACGGCATGGTTTGTTCAGCATATGACCGTGA
CAATAAAGTACGTGTGGCGATCAAGAAGATCAGCCCGTTT
GAGCACCAGACGTACTGTCAGCGCACACTGCGTGAGATTA
AAATCCTGCTCCGCTTCAAGCATGAAAACATCATCGGTAT
CAACGACATCATCCGCACGCCCACCATCGACCAGATGAAA
GACGTTTACATCGTACAGGACCTGATGGAGACAGACTTGT
ACAAGCTGTTGAAGACGCAGCACTTGAGCAATGACCACAT
CTGTTACTTCCTGTATCAGATCCTGCGCGGCCTGAAGTAC
ATCCACTCCGCAAACGTTCTTCACCGAGACCTGAAGCCAT
CAAACCTGTTGCTCAACACTACCTGTGACCTCAAGATCTG
TGATTTTGGGCTCGCTCGGGTGGCTGATCCAGATCATGAC
CACACCGGCTTCCTGACGGAGTATGTAGCCACACGTTGGT
ACCGCGCACCAGAAATTATGCTCAATTCTAAGGGTTACAC
TAAATCCATTGATATATGGTCTGTTGGTTGTATTCTGGCT
GAGATGCTTTCAAATAGACCCATCTTCCCCGGGAAACACT
ATCTGGACCAGCTTAACCACATCTTAGGTATTTTGGGCTC
CCCTTCTCAGGAGGACCTGAACTGCATCATCAACATTAAA
GCAAGAAATTACCTGCTGTCCCTTCCTCTCCGCAGCAAAG
TGCCCTGGAACCGCCTGTTTCCCAACGCAGACCCTAAAGC
GCTGGACCTGTTGGATAAGATGTTGACCTTTAACCCCCAT
AAGAGGATTGAGGTGGAGGAAGCGCTCGCTCACCCGTACC
TGGAGCAGTACTATGATCCTACAGATGAGCCTGTTGCTGA
GGCTCCGTTCAAGTTCGACATGGAGCTGGATGATTTGCCC
AAAGAGACTCTGAAAGAGCTGATCTTTGAAGAAACCGCAC
GCTTCCAGCCAGGCTACAGACCATAGCTGTGCACACAGGC
GTTGGTCTGGATTGATTCATGCTGATGCTTCTGTCTCCAC
TGTGCGCTGTGCTCCTCTTTCGGCCTTTATCGTCTTCATC
TTCATCATCTTGAACCGTAAAACTACAGCCAGCCCTCAAC
GTTCACCTGAACCCAGCCGAAAACATCAACTCCTTCGTCC
ATTACACTGGAAGAAAAGTGTAGAGCTTCTCTCACACTCT
TCCTCTGCATCTCGTCAAGGTTTTTGATTACGATTAATTC
TTTCTCTCCCAGTCCTCTGATATACTTCAGTGAAAAAAGA
C

mapk1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mapk1-003 (1) 904
mRNA mapk1-201 1641
mapk1-203 (1) 1411
aberrant processed transcript mapk1-204 (1) 607
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mapk1-201 Contained in:
OTHER mapk1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000018990 (1)
  • Ensembl_Trans:ENSDART00000030213 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC050169 (1) 1651bp
    GenBank:CK030255 (1) 817bp
    GenBank:CF348022 (1) 774bp
    GenBank:CK239403 (1) 748bp
    GenBank:CF347761 (1) 731bp
    GenBank:BQ258428 (1) 664bp
    GenBank:BI839722 (1) 616bp
    GenBank:AL909691 (1) 602bp
    GenBank:AL909692 (1) 600bp
    GenBank:BG799750 (1) 595bp
    GenBank:AL909693 (1) 577bp
    GenBank:BI866241 (1) 575bp
    GenBank:BG883667 (1) 551bp
    GenBank:CD281023 (1) 392bp
    GenBank:AL909694 (1) 358bp
    CITATIONS (2)