header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1703
Transcript Name: epas1a-202
Previous Name: epas1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050703 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050703|OTTDARG00000035609|ZDB-GENE-030131-4490 epas1a|OTTDARP00000039814 epas1a-001 LG_ CR931998.18 Danio rerio protein_coding KNOWN, 5646 bp
GTCCGTGTCACTCTGGAGAGCTAGTGCGATCCTCGGCAGT
GTTCTGAGACTGCACTGACTGCTCCGGTCACTGCTGGAAA
TGCCATGAGAATGGACATAACCGTGAAGAAATAACTAAAT
AAAGGCATCTGTGATACAAAAAGAGTTTAAACGATTTAGT
TATCTTTCGGGAAAGTTTAGTGAAGTCATTTATACGCAGG
ACAAGGTTCTTCAGCATCATGACAGCCGAGAGAGAGAAAA
AGAGGCACCCTTCAGAAAGGCGTAAGGAGAAGTCTCGTGA
TGCGGCGCGCTGCAGGCGCAGTAAAGAGACAGAGGTGTTT
TATGAGCTGGCCCATCAGCTACCATTACCCCACAGCATCA
GCTCACACCTGGACAAAGCCTCTATCATGAGACTGGCTAT
CAGCTTCCTGCGCACACGCAAGCTCTTCAGCTCAGGCCAT
ACAGTCCAGCAAATGCGGTCGCAAAATTTAGGCCAGATGG
ACAATCTGTATCTGAAGTCTCTGGAAGGCTTTGTGATTGT
GGTCACTTCAGATGGGGACATGATATTCCTTTCAGAAAAT
GTCAGTAAATTTATGGGCCTAACGCAGGTGGAACTGACAG
GCCACAGCATCTTCGACTTCACACATCCTTGCGATCATGA
AGAAATCCGAGAAAATCTCAGCATCAAATCAGGGCCTGTG
TATGGCAGAAAAGGGAAAGAAATGAGTACGAGCAGAGATT
TTTTCATGAGAATGAAATGTACGGTCACTAACAGAGGCCG
CACTGTCAACCTCAAATCAGCCAGCTGGAAGGTTTTGCAT
TGCACTGGGCATTTGCAAGTGTGCAGCAGTCGTCCTCCTC
AGATCCTGTGTGGGTTTTCAGAGCCGCCACTCACATGCAT
CACTATGCTTTGTGCACCGATTCCACATCCATCTAATGTC
GACACACCTCTTGACAGCAAGACGTTCATGAGCAGACATA
GTATGGATATGAAGTTCATTTACTGTGATGAGAGAGTCAG
CAGTCTGATCGGTTACAGACCCGAGGAACTTCTTGGCCGT
TCGGTTTATGAGTTCTGCCACGCTTTGGATTCGGAGAACA
TGACAAAGAGCCATCAAAATCTTTGCAATAAGGGCCAGGT
GGTAAGTGGCCAGTACAGAATGCTTGCCAAAAATGGAGGC
TACGTTTGGGTGGAGACTCAAGCAACTGTCATCTACAACA
ACCGCAACTCCCAACCGCAGTGCATCATCTGCATCAACTA
CATCCTGAGCTCTGTGGAGGAGCAGTCCGTCATCTTCTCC
CTAGACCAGACGGAGGCCTTGTTCAAACCCTACCACACCT
ACGACATGGGCGAAATATTCAGCCAAAACACATCCATTTC
CGAACCTCAGAACAATCTCTTCACTACACTTAAGGAGGAG
CCTGAGGAGTTAGCGCAGTTAGCGCCTATGCCAGGAGACG
CCATCATTGCCTTGGACTTTGAAAGGGCAGAGTTTGAAGA
GGCGACATTCTTCTCCAAGTCCTCCAAGCTCCCTGCGGTG
GGCCCGTCCTGGGTTGTGGACACACCTCCTGATGGCAGTC
CTGAGAGAAACCTGTCCAGCCTGCCGTCCTCCTTCACTGT
ACCCCAGGTGCCTCCAGCAGGCAAATGCACACCCTGTACG
ACACCCTGCTTGAGCAGTTGCAGCAGCTGTTCTACACCTA
ACAGTCCAGTGGATTGCTGTGGCAGTGGAGAGTGGGATCT
GAAGGTGGAGCTGACAGAGAAGCTCTTTGCCCCTGAATCT
GGAGCAACCAATCCAACAGACTCCCAGTTGAACCTGAGTG
ATCTGGACCTGGAGACTCTCGCTCCATACATCCCAATGGA
CGGCGAGGACTTCCAGCTGCACCCTATATGTCTGGAGGAG
CCGGTGCCTGATGCAGGTCCAGGCCTGAGCGCAGCCGTCC
AGCACAGCTTCAGCAGCGTGGCCGACCTCTTCCAGCCCCT
AGAAAAGCAAAGACAGAGTCTTCATTGGCCCCCTGATCAA
CTTTCACAGTATGAAAACACAAATGTTGGCTGCATGGATG
ACAGAAACACAGGAGGTCCAGGACAAACGTGCAATTTCAA
TGTTCCACCACCACACCAAAGATTTTTCGAGAACTTCACC
CCAGTACAGAAAGGCATGAGTTTAGGACAGAGAGCTCTCC
TGAACAACTTTAAACGGAAGAGGCAATCAGAGTTCCCTTT
ATCCTGCTCTTTCTCCGATATTCCAAAGCAGGTGGTCGCT
CCCCACAAGTCTACAGATGGAATGCGAAAAAGGATGAAGC
CGATGAATGATGACAGCTGTGCTTTCTCTGTCAGAAAGTC
TCTCAGCACGAGTGTCCTCACAGATAAATTTCCATGTATG
CAAAGTGGATTGGTTGATCCTCAAGCCTGCAGTCGGTCTG
TCAAAGGGTGTCCAGAGGATCTAAAACAGCACTGCACAGA
CTCATTCTGCTCTAACAGTAGCAGACAGTACAACATGATG
CCATCACGCAAACACACAGGCATGATAAGTCAACTGCTGG
CTCCGTCCTTTGACTCATACTGTCTGCCAGAGCTGACGCG
ATATGACTGTGAGGTAAACATGCCTCTACAAGGAAACCTG
CATCTGCTTCAAGGCAGTGACCTGCTGAGAGCCCTAGACC
AGTCCACATAAGCTGTCCATTCACCCTCTTCATCCAGTCT
TTATGCCTGTATTATCAGCCTCATTTAGACTCATTTGTAC
ATTTTCCTTTAAGACGTGTAATATTTTAATATATAAATCT
GATTGTTACTTGTTTCAAATGTGTTCAGATGTACCTCATT
ATCTCAGACACTAATATTGTATTGTGCCTTCAGAAGCGAA
GTGCTTTTAACATTTATGGTCAGATTTGCTCTTATATGAA
TATCCACTAACTAGAACATGTAAAATATATACAGTTGAAG
TCAGAATTATTAGCCCCCTTATATTTTTCCCCAATTTCTG
TTTAAGAGAAATAAGATTTTTTAAACATATTTCTAAACAT
AAAAGTTTTAATAACTCATTTCTAATAACGGATTTATTTT
ATCTTTGGCACAATGAAAGTACATAATATTTTACTAGATA
TTTTTCAAGATACTAGAATTCAGCTTAAAGTGACATTTAA
AAGCGTACTTGGTTATTAGGTTAACTAAGCAAGTTATGGC
AATTGGGAAAGTCATTGTATAACGATGGTTTGTTCAGTGG
TTCCCAAATTGGGGGTCACAGGACAATGTAATGGGGTTGC
TTGGTGATTTCTAAAAGTCAAATAATTAAACTGTTATTAA
ACTGTTAGAATAAGCCTACCATATTTTATCCATAACTCTG
ACAGAAGTTAAGAAGATAAAAATAGTAGTCAATAGTTACA
AAACATGCCCATAGCCAGGGGGGTTCTGGTGGTTCAAACG
ACCCACCCCACATGGCCAAAACGTCCAGAACTTGTCCTTT
TAATTATTTTATGTAATTTAAAAATATGTATATTTTATAA
TAACGTGTCATTTTAAACAACCATGGCCAGTAATTCGAAT
GCCAAGGAGCCTCAAAGCCACATTAATGTGATGCGAGTCG
CCATTTTAGTGCCACAAAAGCAGGCAGCAGTGTTATTGTC
TGCACTGGTACTGCAAAAAGCATGCAGATGATTCCAGAAG
ACAAGCTAATCTAGCACAAAATATTTCATAAAATGTCACC
AAAATGCTGTAAACTTCTTAATCAAATACAAAATGTGGGG
GAAAAAACAAAAAAAGGTCAGCTTAAGAGAAAAAGAACCC
CTGAGGTTAATTAATAAATGACTATAAAATTATATGGCTG
TTAGATTGTTGTATTTTTTCTGTTGTCAATATGCTCGTTT
ACAGTGCTCAGCATAATTGAGTACAGCCCATTTTGAAAAT
GAATATTTTCATCCATTTCTCAGTGAATCCAGGCAATGTA
TTTTGGTGCATTTAAACAAAACAGATTTATTAAACAGATA
TATTTATTTAAATAATAGTTTAGTCACCAAAATATTAAGA
ATAAAAAATACAAATAAATTCAAGCTGATTATTGCAAAAT
AAAAAAAAAATAAAAAAATAAAAATTTTATTTCTCTTTTT
TGCTTCTCTTGATTTTTCATGTTTTTAAAACTTGTATTTA
ATATTTTTCTATAACATAAATTCGGGTGTACTTGTTTTTG
GACAGTTATCGCAAGTTATTTTGTTTGATAAGCTCCAGAT
TTGGCTTCAGTCTTGACTAATCTAATATATATGCACACAC
ATAATGTTGTATAGCTTCCTTTTAAAAATATGAATTTAAA
AGATCATATTCATATTCAGAATACTCATATATGATGAGCA
CTGTATATACCATAGGACTTATTGTTTGCATAACGTTTGT
ATATTTACAACCACCTCTGAATTTGGGTGTCGCGAGTCAC
TGGCATTGTTATTTTGGGGGTCACAGGCTAAAAAGTTTGG
GAACCCCTGCTGTAGACAATAAAATAATTTTGTTCTATCC
AAAACAAATAAGACTAAGAAAAAATATTATAGGAAATACT
GTGAAAAAAAATCTTTTCTCTGTTAAACATCATTTGGGAA
ATATTTGAAAAAAAAATATTCACAGGAGGGCTAATAATAT
TGATTGCAACTGTATATAAAATGGTAGTTGCATTTGTAAC
TTATTCATTCAGCTTGAAATATTGAAATACTGCCTTTGTG
TAAATCAACTCTTTTGACGAAAACATTGCCCTATAAATAT
TCGCTCTGAAACTGTACCAGCAACAAATGTGGCGTAAAAC
TGTGTAGCTGTTTTTCTTTGTCAGCTTTCTGACAAAGATA
ATTCATAATGATAGAACGCTGTATTAAATGTATACTTTCT
GTTATCTTAAGCACTTTATTTTAAAAGATGCAAATGGAGG
ACCAAACTGAAAAACTGAGCATCTTGGCCATTTTTAAGTG
TGGGGGGCTGTCCATCACTAAACCATCATTTACAACAGAG
GTTCTCAATCCCAGTGTCCTGTAGATTTTAGCTCCAATCT
GAATCACACACACCTGGGCTAGCTAATCAAGCTCTTACTG
TAAAACCCGAAATGTTAAGTTAACTCAAACAGTTTGAGAG
AACCGATTGCAGCAAACCATTTAGGTTCAAAAACTAGTCC
TAATGAGTACTGTGAACTTAATCCATTTGAGTAAATAAAG
CAATTTGAGCACAGTAAGTAAATGAATAGAACTCAAACCA
ACTGAGTACTGTAAAACCCAATAAGTTAAGTCAACTTAAG
TCAACCATCTGAGGAAACCGATTGCTACAAACCATTTGAG
TTCAAAAAACGAATCTATATGAGTACAGTGAACTTACTCC
ATTTAAGTAATGAGGTATTTATTTACCTTATTACCTTCAA
CACTGAGTGCAAAACTCTTTTGTGAAATGCGTAGAATTAA
TTTTCAGTCAATTTTGAGTTAACTACACTCATTTGATTTG
ATAAAGCTGACTGTTGGGTTTTTACAGCTTTCCAAAAACA
TCCTTGAAGGTGTGTTGAGGCAAGTTGGAGCTAAAATCGG
CAGGACACCAGAGTTTGAGATCCGCTGCTGTGAAATATAG
TCTTTATTTGAAAACTGAGTTGTAAATTCAAAAATTATTT
TCATATACAAACATATCTATTGCGTCTACATTAGATGAGG
TCAGAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
epas1a-202 Contained in:

OTHER epas1a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050703 (1)
  • Ensembl_Trans:ENSDART00000149198 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN858183 (1) 820 bp
    GenBank:EB791138 (1) 652 bp
    GenBank:CD596235 (1) 650 bp
    GenBank:CD599693 (1) 650 bp
    GenBank:AI959496 (1) 548 bp
    GenBank:BI326683 (1) 548 bp
    GenBank:EE201725 (1) 515 bp
    CITATIONS (2)