header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1396
Transcript Name: tollip-201
Previous Name: tollip-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049355 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049355|OTTDARG00000034790|ZDB-GENE-030131-8820 tollip|OTTDARP00000038726 tollip-002 LG_ CU463038.10 Danio rerio protein_coding KNOWN, 918 bp
GGATCCAGGACACAAGCTTGAGAGGAAACTCATGAGTAAA
CACAGTCCGACACTCACAACACACTGGAAGAAGGTGATGA
AGACCGGCGCGTCGAGCTCCTTGCTGTCTAACAGGTTTAC
ATCGGTGAGTTGCCTCAGGATTTTCTGAGGATCATGCCGA
CTCAGCAGCAGCAGCAAGTGCAGTTAGACGCACAGGCGGC
CCGACAGCTGCAGTACGGAGGATCTTTAGGCACTGCTGGA
CGCCTCAGCATCACTGTAGTACAGGCTAAGCTTGCAAAGA
ACTATGGTATGACACGGATGGACCCTTACTGCAGGATTCG
ACTGGGCTACGCTGTCTACGAGACTCCAACCGCTCACAAT
GGAGCAAAAAACCCTCGCTGGAACAAAGTCATCCAGTGCA
CCGTCCCTCCCGGGGTGGACTCCTTCTATCTGGAGATATT
CGATGAGAGGGCGTTTTCTATGGATGATCGCATCGCATGG
ACACACGTCACAATCCCTGAAAACCTGCGGGAGGGAACTG
TAGTGGACGAGTGGTACAGCCTGAGCGGGAGACAGGGGGA
CGACAAAGAGGGCATGATTAATCTCGTCATGTCCTTTGCA
ACAATACCCGCAGGAATGATGATGCAGCCGCAGCCTGTGG
TTCTGATGCCTACAGTCTATCAGCAGGGAGTCGGTTATGT
GCCCATAGCAGGCGTCCCTGGGATGTATAATCAGGGTGTG
GTGCCCATGGGGATGCCAGCCGCTCCTCCAGTGGCGTCTC
AGAGTGCCCCATGCAGCGAAGAAGACCTGAAAGCCCTTCA
GGACATGTTCCCCAACCTGGACAAAGAGGTGATCCGCACG
GTTTTAGAGGCGCAGCAGGGAAATAAAGATGCTGCCATAA
ACTCCCTGCTGCAGATGGCGGAGGAGCTTTAACCGCAC

tollip TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA tollip-201 918
tollip-202 (1) 1305
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tollip-201 Contained in:
OTHER tollip-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049355 (1)
  • Ensembl_Trans:ENSDART00000166544 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH451009 (1) 926bp
    GenBank:DT866920 (1) 839bp
    CITATIONS (2)