header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1312
Transcript Name: cd276-202
Previous Name: cd276-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049086 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049086|OTTDARG00000034656|ZDB-GENE-070112-452 cd276|OTTDARP00000038521 cd276-002 LG_none CU651632.8,CU896640.11 Danio rerio protein_coding KNOWN, 491 bp
ATTCACTTTCCGAGTCCGACCGGAGGAAAAAATTGAACCA
GCTGGACTCGAGCAGCCGCTGTTTCCCTCATCATCATCAT
TTCTGCGGATAAACATGAGCTTCCAGAGAGTTCACCGGAG
CTGAGGGCCTGATCGGGAATGCCGGAGCCCGCAGAGAGTG
CCTTTTCCCCGGTCTGCTGATACAGAGAAGCCGCGCCGAA
CCCTGTACTCTTTTGTCTGGACTGGAGCGCCACACCCGCC
GGACACTCGGAGACTGCGCTCTTAAATTGAGTGTCGTGAT
TGAAGGATCTGCCCTGCTGTCTCACACACACACACACTCT
CACGTCTGCGTCGTCATGTTGGCCCTCCTGCTGTTTTCTC
TGCTGGTGCTTCAGTCTCACGCTCTGGATGTGCGTGTCCC
AGAATCCCCTGTGGTGGTTCTGTTTGGGTCGGATGCGCTG
CTGAACTGCTCTTTTTCGGGTGTTTCTGCGTTCAATCTGT
CGGATGTGAGT

cd276 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cd276-202 491
cd276-203 (1) 2136
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cd276-202 Contained in:
[Fosmid] CH1073-312B22 (1) (order this)
OTHER cd276-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049086 (1)
  • Ensembl_Trans:ENSDART00000149912 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB859373 (1) 497bp
    CITATIONS (2)