ZFIN ID: ZDB-TSCRIPT-110325-1216
Transcript Name: itgb1b.2-202
Previous Name: itgb1b.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048724 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048724|OTTDARG00000034442|ZDB-GENE-060803-3 itgb1b.1|OTTDARP00000038220 itgb1b.1-002 LG_ CU693495.8 Danio rerio protein_coding KNOWN, 2565 bp
ACTGAACGAGACCTGCGCACACCTCACACACAGTCCCAGG
ACTTTCCCACACTTTTATTTCATTTTTTCTGTATTTTTTC
ATATGCCCTCAGGACTGTTAAAGGGTACTGTAACCCAAGA
CCATCAGGACAAGTTGATCATATAAACATTTACTTCCTAA
ACACATAACTCTAGGAAGAGGGTTGGAGAGCATGAGTTAA
GATGAAAATGAAGCTGCTGTTATTATCAGCTCTACTTGGA
TTTGTCTTTTATGTTGGAGCGAAAACAGACAGTAATCCAT
GCATTTCTGCAAATGCCAAAACCTGTGGAGAGTGTATTCA
GATCGGCCCACAGTGTGTGTGGTGCAAAGATCCTGATTTC
AAACCTTCACGCTGTGATGACATTGAGTCCATGGCGAAAG
CTGGCTGCACTGCAGACGGTGTAGAAAACCCTAGAGGAGC
GGTCACTATTGACAAGAACAAACCCGTCACAAACCGTAAA
ACTGATGGAGGACAGAATCTGAGGCCCGATGAAATCACAC
AGATTCAGCCACAGAAAGTCACGCTGAACCTTCGCTCAGG
AGAAGCACAGAAGTTTACTCTCAAGTTTAAGAGGGCAGAG
GATTATCCTATCGATCTGTACTTCCTGATGGACCTCAGTC
ACTCTATGGTGAGCAATCTGGAAAATGTTAAAAAGCTGGG
AACCGAACTCGCCAATGAGATGAAGGACATCACGAAAGAC
CTGCATATAGGTTTTGGTTCATTCTTGGAGAAGCTGGTTA
TGCCTTACATTCTGATGACGCCAAAGTATCTGAAAAACCC
CTGTTTTCCAAGCGACTGCACTGCGCCCTTCAGCTACAAA
AACGTCCTGAGCTTGACAGACAATCATGGATTGTTTACCC
AAGAAGTCAGCAAGCAGAAAACCTCTGGAAACCTGGACGC
TCCGGAGGCCGGATTTGATGCAATCATGCAGGCTGCTGTC
TGCACGGACGTGATTGGCTGGAGGAATGTCACTCGTCTCC
TTGTGTTTTCCACGGATGCTGGATTTCATTTGGCTGGAGA
TGGAAAGCTTGGTGGCATCGTTCGTCCTAATGATGGGAAA
TGCCATCTTGACAATAATATGTACACCATGAGCAACTACT
TTGACTACCCCACCATCTCTCAGCTGGTAGACACACTGAG
TGGCAACAATATTCAGACTATCTTTGCTGTGACTGAAGAA
ATCCGGGAGATTTATCAGGAGCTGTCTGCCCTTATCCCAA
AATCAGCTGTGGGGATACTGTCTACCAGCTCTTCCAATGT
CATCAAGCTCATCATCGATGCTTATAATTCTCTGTCCTCT
GAGGTGATTCTGGAGAACAGCAAGCTACCTGATGGTGTGT
CCATCTCTTACGTCTCCCACTGCAAGAACGGAGTGAGTGG
AACAGGAGATAATGGGAGAAAGTGCTCCAACATCTCCATT
GGGGACGAGGTGTTGTTTGATATAGAAATCACGGCTAAAG
GCTGTCCGTCTAAAGGTAAACCAGAGACCATAAAGATCAA
GCCGCTGGGGTTCAGCGAGGAGGTGGAGATCCTCCTCAAC
TACATCTGTGAATGTGAGTGTCACAAAGACGGGATCAAAA
ATAGTCCCAAGTGTAGCGGAGGACAGGGAACGCTGGAGTG
TGGAGTCTGCAGGTGTAATGAAGGTCGATTAGGCAGATTA
TGTGAGTGTAGCCATGATGAGGTGCTGGCGGATGATCTGG
ATGCAAACTGCCGTATGAATAATGGCACAGAAGTCTGCAG
CAACAATGGAGAATGTGTCTGTGGAACCTGTGAATGTAAG
AAAAGAGACAACCCAGAGGAGAGATACAGCGGAGAGTTCT
GCGAGTGCGACAACTTCAGCTGCGACCGCTCAAACAACAA
GCTCTGTGGAGGTCATGGCCGATGCGAATGTAAGAAGTGT
ATCTGTGATGCTAACTACACCGGCAGTGCTTGTGACTGCC
CTCTCGACACCGCAACTTGTCTGGCCAGTACCAATGAGAT
CTGCAATGGTCGTGGCAAATGCGAATGTGGCGTGTGTAAA
TGTGATGAGAATTATGAGGGTCCGACTTGTGAAATCTGCC
CAACCTGCCCAAGAATTTGCACCGAACGCAAGGATTGTGT
GGAGTGCAGACATTTTGGTACAGGCAGCAAGCAAAAGACA
TGTGAGGAGGACTGCAAATCTTACAGCATAAAGAAGGTGA
AGACTAAGGAGGATCTTCCTCCGCCTAACATTAATCACTG
CAAAGAGCGAGATGTTGATGACTGCTGGATCTTTTTTACT
TCTTCTATCGAGAAAGATGGCAGCATTCAGGTCTATGTGG
CTGAAAACAGGGAGTGTCCCTCTGGCCCTGACATCATCCC
CATTGTAGCAGGTGTGGTTGCAGGAATCGTACTGATTGGC
TTAGCCCTTCTGCTCATCTGGAAGCTGCTCATGGTAATTC
ATGACCGCAGAGAGTTTGACAAATTTGAGAAAGAGAAAAA
TAATGCCAAGTGGGATACGGGCGAGAACCCCATCTACAAG
AGCGCTGTAACAACTGTGGTGAATCCCAGATATGAGGGAA
AGTGA

itgb1b.1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA itgb1b.1-201 (1) 2451
itgb1b.2-202 2565
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itgb1b.2-202 Contained in:
OTHER itgb1b.2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048724 (1)
  • Ensembl_Trans:ENSDART00000148454 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DQ149103 (1) 2364bp
    GenBank:EB772067 (1) 412bp
    CITATIONS (2)