header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1195
Transcript Name: cdadc1-203
Previous Name: cdadc1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048643 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048643|OTTDARG00000021836|ZDB-GENE-041114-163 cdadc1|OTTDARP00000038161 cdadc1-003 LG_ BX294379.5 Danio rerio protein_coding NOVEL, 2138 bp
GCAAATAGGAAGAGGACAGCATGAAGGTGGACTGGCTGTT
GTTGTTGTGTCTGTTTAGTCAATGACAGGTCAATGTTGAT
CGTGTTTGAATGGCGGAATCAAACAGCTGGAGGTCTCACC
GGGAGTCCGACGGGAACAGATCGATTCCGAACGGCGACGA
CGCCCGCAATGTCCGGGAAACCGGAGTACAGACCGATGCC
AAAGTACAAGGTCAGGGGCCTCGACTATCCAAAGCCAACC
TCTTCACACTGTTGAGTCTATGGATGGAGCTTTTCCCAAA
GAGAGAAGCCTGTCAACAAGAAAACGATGCTGCTGGAGTA
AGTGGTCTTGTGGTGGTCCACGAGTGCAGAGTTTTGGGTC
TGCATTGCTCCAGTGCTCAGTTACACGCAGGACAGGTGGC
TGTGGTCAAACATGGACCCAGACTGAAGAGCTGTGAGCTC
TACTTCTCCAGAAAACCCTGTTCAACATGCCTGAAGATGC
TCATCAATGCGGGAGTGAGCCGGATCTCCTACTGGCCTGG
TGATGCTGAGCTCAGCCTGCTGTCTGAAAGCCTCCATCAC
GGCAGCTCGTCTGCTCTTCAGGAAGCTGTTCTGGACGCCA
CTGCAGCAGAACGCCTGAAGTCCAACAGCAGACCTCACAT
CAGCGTGCTCCTGCAGCCCCTGGACTGCACCGTCCTGCAG
TTCCTGGACGAAACCTCACAAAACGCAGACTTTCTTGGGA
AGATCGTTGCGGACAATCCGGCGCTGGACACTGGAGATAT
CTACCGGAGGGAATTTTGGAACAACTCGGACAACTTCTTA
GAGAAGTTCTTCATAAGCGATGAGGAGCGGCATAAGTATG
TGCTGAACAAGATGGGGCTGGAGAACTTTTGCATGGAACC
AAATTTTAGCAACCTGAGGCAGCATATGAGGAATCTGATA
CGGATCCTGGCGTCTGTGGCCTCTAGTGTTCCCGCTCTTC
TAGAAGATTACGGTTTCTTCATGAGGGAGCCTGTTGGGAT
GGGTTCTCCAGGTTTACCTCAGGATGTCATACGACACTGT
GTCATACAGGCCCGCTTACTGGCGTGTAGAACAGAGGATC
CTAAAGTTGGAGTCGGTGCAGTTATTTGGGCAGAGGGAAA
ACAGTCACAGTGTGATGGCACGGGTCAGCTTTATCTAGTG
GGCTGCGGATACAACGCTTATCCAGTGGGCTCACAGTACG
CAGAGTATCCTCAGATGGACCACAAGCAGGAGGAAAGACA
GAACCGGAAATACAGATACATCCTTCACGCAGAGCAGAAC
GCACTCACGTTCAGGAGCGCAGAGATCAAAGCAGAGGACA
ACACCATGATGTTTGTGACCAAGTGCCCGTGTGACGAGTG
TGTCCCTCTGATTGGCTGCGCTGGAATAAAGCAGATCTAC
ACCACTGACCTGGACAGCAACAAAGTCAAACACGACATCT
CATACCTCAGGTTCAACAAACTCAACGGCGTCCAAAAGTT
CATCTGGCAGCAGAGATCTTCCATTAGAAACACTTCAGAA
CAAGATGCTCTCCCTACAGCAAATGGTTGCTTTAAACGAA
AAGACGAGGAAAGCAGTTTTAAGTGCAATAAAAGACCGCG
ATCTTAGATGATATTTTAAAAGCTGCTTTTCTGTCTGCAT
AGCAGCAACATTTTCAGATACAGCAATTAATACTGTACAT
CAGAAACTGTCCAACACCCTGATGATGAAGAACAGTTGAA
CCTGCCGTCCTCATATGCTGCATGATGCAAATCAGCAAAG
TGTTTATGTTTAGCGTACTGTAAATGCATTTCAGAGACCA
GGTTTGGGGACTTTGGGGTTTTATAATTGCGCATTAATTG
TCAAATTGACAAGATAACCGTTTCATCATGTGCTCGTGTG
AAATATATTTATTGAAAATGGAGAATTTAATTTACATAGC
ACAAATTTGCACTATTGCATTTTTTTGGGGGGAAAAAATG
AGTCAATGATGCTGCTAATGCTTCACTTGATCTTTATTGA
TACGGTACTTTTAGCATTTCAGATGAAAACCGCACCGGTG
TTTGTAGTAGGAAAGATTTTGACTTCATATTGTGAACACA
CGGTTTGGCATTTTCAATGTAAAGGCTGACAAATATTCAA
TAAATGTGGCTCAGACGG

cdadc1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cdadc1-002 (1) 539
mRNA cdadc1-201 (1) 1707
cdadc1-203 2138
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdadc1-203 Contained in:
[BAC] DKEY-7A20 (1) (order this)

OTHER cdadc1-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048643 (1)
  • Ensembl_Trans:ENSDART00000148893 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH434107 (1) 927 bp
    GenBank:CO352911 (1) 600 bp
    CITATIONS (2)