Transcript

smpd2a-201

ID
ZDB-TSCRIPT-110325-1080
Name
smpd2a-201
Previous Names
  • smpd2-001
  • smpd2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048098 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048098|OTTDARG00000034077|ZDB-GENE-051014-1 smpd2a|OTTDARP00000037740 smpd2-001 LG_ CU570774.9 Danio rerio protein_coding KNOWN, 1702 bp
GCTCACGACGGGAGCGAGTATCGAGCGCGCGTCCGCTGAG
GTGCGCGCGGAGCGTCGATTTAAGTGGCAGGCCCGTGCAG
GTATTTATTTACACGCCATAACATCTGCCTAAATCCTATT
CTAGATATAACGTAGTGCGTGGAATTATACGAATACGTGT
TGACTCTCAGTGTAAAGCATTTAAATGTACGAATAAAGAG
TCACTGATGAGTTTGACGGTTGTGCGGATTAGTTCAAAGC
TCCGCCTTAGATGCGCGCGCTCGCAAGTGTGTCCGTGTGT
GTTTTCAATGGGCTTTAAAGCGCACTTAAATGACTGGCTC
TTTCAGGAGCGGACTGAAGCGGCATCATGGCACCACAGCA
GCCCGGCAACCTGCGCGTCTTCTCCCTCAACTGCTGGGGT
ATTCGTTTCCTCAGTAAGCTCTGTGCGCAGCGGTATGAGA
TGATTGGGGAGTTGCTGGGCCGAGAGCAGCACGACATCGC
ACTCTTGCAGGAAGTGTGGAGTGAAAGAGATTTCCTGTTC
CTGAAGAGAAAGCTCTCCTGCTCTCATCCTTACACACACT
ATTTCAAGAGTGGGGTCATTGGCAGTGGTCTTGCTGTGTT
TTCCAAACACAGAATCCAGGATGCTCTGCTTTACCAGTAC
TCTCTCAATGGATATCCATATATGCTAAGCCATGGCGACT
GGTTTGGAGGTAAAGCAGCTGGACTGGTCATTGTAGAGGT
TTTTGGGTTAAAGGCACACGTCTACGTTACTCACTTACAT
GCCGAGTACTCCAGGGCTCAAGATGGATACCTGCCTCACA
GAATAGTGCAGTCGTGGGAACTGCAGCAGTTTGTGCGCCA
CACATCCCATGGAGCAGATCTGGTGATTTTGGGAGGGGAT
CTAAACATGCACCCTCAGGACCTTGGAAACCGTCTTCTCA
GGTCCCACACTGGACTCAGAGACTGCTATACTGAAACAGA
TAAGTTTGATGGCTGTGAAGATGGCCACACACTAATAGCA
AACAATCACTTCACAAAGAAGCAGGATCTCATTCCTTTTG
AGAAGGGCATCAGGATTGACTATATTCTCATCAAGGGCTC
TCAGAGAGTGAGCGTGAAATGTGAGTCTCTGTCCACCACC
AAGGGTTCAGTGTCTGATAAACCCTTTCCATATTCTGACC
ATGAAGCTCTGATGGCCGATCTGAACCTGCTGAGCTCACA
GGACTGCACTGATGCACCGCCTGCATCAGATCAAATGGAT
GTAGTCTCGGAGGCGCGTGCGGTGGTGAAGGAAGGCCTGG
GTAAAACCGAGGCGCTGCGGGATCGATCTCTGCACCTGAT
GTTTGCTGGTCTACTTCTTCTACTGCTGGTCTTGTGCTCC
AGCAGCTTCTTCTCCTTCAGCGCTGCAGGGTTTCTGGGAG
CCGTGTGTGTGTTTATACTGCTGTCTGGGGCTCTGCTGTA
CATGCTCTTCACGACACACATCAAAGTCCTGAAAGAGACT
GAAGACCAGATGATGCTCCGCTCGCAAAACCTCCAGACCA
AACTGACTGGATGCAGAGTCTCTGGATCTTCATCTTCTTT
TCACGCTTCTCCAGAAATCCAACCGTCGAGTCCTTTCAAA
CGGGAGGAATAAGGTTGACCGTATAGTAAGTGCTGGTCCA
GGATCAGGTTACTGGTTTTCAGTGTTACATGGTAAAGTGC
AACAGTCGGTTCCGGAAGTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations