header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1075
Transcript Name: rabggta-201
Previous Names: rabggta-001, ch73-212e20.2-001, zgc:153107-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048083 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048083|OTTDARG00000034070|ZDB-GENE-060929-1042 rabggta|OTTDARP00000037732 CH73-212E20.2-001 LG_ CU693481.9 Danio rerio protein_coding KNOWN, 2995 bp
GTTTGAATTACAGCTCGGCATTTACGACATATCCAGCTCA
GTCTGCATTCAAAGACCGAGATCTGTCCATCCGCTGGTGA
ATTATGCACGGCCGTGTGAAGGTGAAGACGACAGCGCAGC
AGGAGGAGGAGAAGAGGAAGGAGAGAGAGAAGAAGCTGAA
GGCCTTTGTGTGCGCGCGCGACTCTGTGCTGAAGAAGAGG
AGCGCTGGAGAACATGACGAGGAGGCTCTTGATCTCACAC
AGCAGCTTCTGTCCTCAAACCCAGACTTCGCCACACTCTG
GAACTACAGGAGAGAAGTGCTGCTGCATCTGGAGACGCTG
CGAGAGAAGGATGAGGTGCAGAAGCTGTACGAGTCTGAAC
TGCACTTCATTGAGGCCTGTCTGAAAGTCAACCCCAAATC
TTACGGCTGTTGGCACCACCGCAGCTGGGTGAACACTCGT
CTCCCGCAGCCCGACTGGACACGCGAGCTGGGCCTCTGCG
ACCGCTGCCTCAGCCTGGACGAACGCAACTTCCACTGCTG
GGATTACCGCCGGTTGGTGGTGAAGGAGTCTGGCGTTTCC
GTGGAGCAGGAGCTGCAGTTCACCGACCGTCTGATTGGCT
CCAATTTCTCCAACTACTCCAGCTGGCATTACAGGAGCAC
ACTGTTACCTCAGCTCCGCCCACAGCCGGTGCTGGACTCC
GCCCACAACACAAGCCCCTCCCCCTCCGCCTCGCCTCAGA
GTCACTCGCACAGAGTCTGCGAGGAGCAGCTGCTGAAAGA
GTATGAGCTGGCCCATAATGCCTTCTTCACTGACCCCAAT
GACCAGAGCGCTTGGTTCTACTACCGCTGGCTGCTGGGCA
GAGCGGAGAGAGAGGAGATGATCAGCTGTGTGTACGTCAG
CAGGGAGGGTGAGAGAGTTTCCGTCGCCTTCTCCAAACCT
GTTCACGCCGGGTCAGTGGGTCTGATGTTGGTTCTGGACG
GTCAGCCTCAACAGGTGCAGTGGAGAAATGCACATCCCCG
TCTGCGCCACAGTCCTGTCTGGCTGTGTGATCTTCCTGCC
GGCTCCATCAGTGACACCAGTAATGAACACAACCTGACCA
TTCACTGGACAGACAAACACACACACAGAGACTGTGCTCT
CTACACGGGCTGTGCTGAAAGCTGGTGTAGAGACTCCGCC
ACTGATCAGGAGCTGTTCAGGAGTGAGCTGTCAGTAGAGA
AGAGTTCAGTTCTTCAGGCTGAGCTTCAGTCCTGCAATCA
GCTGCTGGATCTCGAACCTCAGAACAAATGGTGTCTGCTG
ACCATCATCCTCCTGATGAGAGCTCTGGATCCTCTGGGCC
ATGAGAAAGAGACTCTGACCCATTTTCAAACCCTTAAAGA
AGTGGATGCGATGCGCTCCTCCTACTACAGTGACCTGTGC
AGTAAGTTTTTGATTGAAAACACCATCCTGAAAATGGAGT
ATGCAGAGGTGCGCGTCTTCAGCCTCTCCAATAAGAAACT
GACCACCTTGTGTCACCTGGATCAGCTTCTGCTGGTCACA
CACATCAACCTGTCGTCCAATCAGCTGCAGCATCTGCCGC
CTCAGTTCAGCATGCTACAGTGTCTGGAGGTGCTGGAGGC
TGATGATAACGCCATCGAAAGTCTGGAGGGTCTCTATCAT
CTGCCTAAGCTAGAGGAAGTTTCTCTGAAGAACAACAAAA
TCTGCAAAGTGTCTGATCTGGAAACACTGGCGACCTGCAC
CAAACTGACCAGACTGGACCTGCGTGGAAACCCTGTCCAC
AAAACTGACGACCTGGAGTCTGAGCTCAGCCTGATCCTGC
CATTGGTCACTGCCCTGTCTCTCTGATATGTGTGTGTGTG
TACTTGTTTTTATCTCCCAGTGGGGACTTAAACCTGAATG
CACACAGACTTATGGGGACTTGTGTCACTGCGGGCACCAG
AATTGATGGGTTAACATGCTTATAGATCAGACAGAATTAA
GTATTTTAAATATGTAAAGGGGCAGATTGTTTGCTGTGAG
GGTTGGTTTAGGGGTACAGTTGGAGGAGGGGAGGGAATAT
ACAGTTTGTATAGTAGAAACATCATTACATCTATGAGAGT
CCCCACTGGGATATAGGAGCCAGTCTGAGTGTGTGTGTGT
CTGTACTGGTTTTGGTGGTTTACAAGAACAGACATTTGTA
AAATGACATGAGTAAGGCCTACTGTAGGTATTACAGCATT
GATGTGGTTTATGAGGACAGGCCTTGAGTCCTTGTAAGTC
AAAACCCTTAAAAATCATACTTCAGGGTCTTTTGACATTC
AGATTTTGCCACAGGTTTACAGTGAGGGTTGGGTTTAGTG
GTAGGGGAGGGATTATGGCATATAATAGGAGTTTTTTTTT
TACTGTATAAAATGTATGGAGAGTCCCCGTAAACCATATA
TACTGTACTAGTGTGTGTGACATACTAACTGTACCACTTT
AGAGACCCCTTAGAGCAATTTCTGAACATGTAACTCACGA
GCTGGACCTAATAGGACTTAAAGGGATAGTTCACTCAAAA
ATGAAACCAAGATACTTTGAGGAATGTTCCTGCTGTTCTT
TTCTACATACTGCAGAAAACACTAGAGAGCTACAGTGAAG
AGGATTGTTGGAATTTAGAGGTATTTCACCTGAAAAAAAA
AACACAAAAAAAAAACACCACAGCAGATGTTGATTTTTGA
GTGAACTATCCCTTTAAAAATATTCAGCCTCTTTGTGTGT
GTGTGTGTGCGTGCGTGCGTGCGTGCGTGTGTGTGTGTCA
GTGTTTGTGTGTGAGACGAATAACGGTTCACATTTCAACA
AAGAGCTCTGTATAAAGGCCTCACTGCATGCTGATGGAGA
GAAATGTTCTGGTCACGTCTGCTGTTACTTTTAAGTTCTC
AATGATCCGTTTGGCCAAAGATATTAGTGACGTTTCAGTG
AAGATGCAGATATTCGGCTGTGCGTTTCTTGTATCGTATG
AATCTCCATGCCAGTAAAGAAACTGTTTAATCTCC

rabggta TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rabggta-002 (1) 881
mRNA rabggta-201 2995
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rabggta-201 Contained in:

OTHER rabggta-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048083 (1)
  • Ensembl_Trans:ENSDART00000149357 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC124249 (1) 3015bp
    CITATIONS (2)