header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-100
Transcript Name: si:dkey-288i20.2-202
Previous Names: dkey-288i20.2-001, si:dkey-288i20.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047870 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047870|OTTDARG00000033941|ZDB-GENE-110411-17 si:dkey-288i20.2|OTTDARP00000037572 DKEY-288I20.2-001 LG_ CU467885.10 Danio rerio protein_coding PUTATIVE, 1126 bp
GATAGATCGTCTCCACGGGCGGACTGTTATGGCGGAACCT
TCATCGCGGAGAGAGGATGAAGAATGGCAGGATTTTAACG
AATTTAAGGGCGGAACGGGACGGAATTTGGATGTTAGCGC
GGAGGAGACGCGGCTGTCGCTGCTGCTGCTGCTGGACGAG
CTTTCAGACGCCGAGAGCGCGCTTCAGACGGGCGCGTTCA
CGTCCACACACTTCGACGAGAACCTACAGCTGTGCTTTCA
AGATGTGCACTCGAAAACGGACGCAGGAAATGAACTGACG
TCTTTAAACGAGGAGACGACGCTAAAATGCGACGAGATCT
GGAGCGCTCTGACCGATAATTATGGCCACGTTATGCCGGT
GGACTGGAGTCAGTCTCGACGGCTGGAGAGTGTGAACCTG
GACGTGTCTGATGATGAGGAGCTGCGGGATCAGATGGACA
TGCACTCTATCATTGTGTCCTGCATCAACGAGGAGCCGCT
GCTCACTGCTGAACAGGTTATCGAGGAGATCGAGGAGCTC
ATGCAGGAGTCACCAGAGGTGGAATCAGAGCAAAACGTTT
CACACTCAGGCGTCTCCTTCATCTCTCAGAAAAGATCTCA
CAGCAGCCAGATCTACGAGGACCCTCTTTCTGCAGGAGTG
AGGCTGATGTCCGTGCTGGAGCTGAACGATGAGCTGGAGG
ACGTGGAGACGGCCATTCGAGGATATTCAGAGGAGCTCAT
CCACCATCTGGCCACCAGGGACGAGCTGGAGTTTGAAAAG
GAGGTGAAAAACAGCTTCATCTCGGTGCTCATCGACGTAC
AGAACCGGCAGAAGCTGCAGCGAGAGATGCTGAAGAAGAA
GAGGAAAGTGAGGAGCACGTCAGGATCAGAGAGACTGCCG
TCTTCTCGCTTCAGCATGGAGGGAATCTCGACCGCTATTC
AGAATGGTTTTCGGCACACTTTTGGGAATGGGGGCGGTGA
GAAACAGTATGTAACAACAGTCATTCCTTACGAGAGGAGA
GACGGTCCACCGTCAGTCCAAGACCTTCAGATCTTTACCA
AAATTTTAGAAGCCATGAGAGACGACAGCGATAAAGTCCC
AAGCCTCCTCACAGATTACATCCTCAAAGTTCTCTGTCCC
ACCTAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-288i20.2-202 Contained in:

OTHER si:dkey-288i20.2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047870 (1)
  • Ensembl_Trans:ENSDART00000148512 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC124379 (1) 1862 bp
    CITATIONS (2)