ZFIN ID: ZDB-TSCRIPT-100915-666
Transcript Name: dct-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: artifact
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045983 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045983|OTTDARG00000032848|ZDB-GENE-000508-1 dct|no_translation dct-002 LG_ CU694472.5 Danio rerio protein_coding KNOWN, 1077 bp
CTGCGCAGGAAACTTTGCCGGCTATAACTGTGGCGAGTGT
AAGTTCGGCTGGACGGGGCTGAACTGTGACCAGCGTAAAG
CTCCGGTGCTGCGGAAAGACATTCACTCTCTGAGTCCGGA
AGAGCTGCAGGAGTTTCTGAACGCACTGGATCTCAGCAAA
ACCACCGTTCATCCTGATTATATGATCGCCACACAGCACT
GGCTCGGCCTGCTGGGACCCAACGGCACAGAACCACAGTT
CAGCAACATCTCCATATACGACTTCTTCGTCTGGCAGCAT
TACTACTCCGTCAGAGACACGCTTCTGGGTCCTGGACGTC
CTTTTAAAGCCATCGACTTCTCGCACAAAGGCCCAGCGTT
CATCACCTGGCACAGATATCACCTGCTCAGCCTGGAGAGA
GAACTACAGAAACTGACGGGTAATGAGAACTTCGCCGTGC
CGTACTGGAACTTTGCGACAGGCCAGTCAGAGTGTGACGT
GTGCACAGACTCTCTGCTGGGAGGACGAGACCCCAGTGAC
CCATCCCGAATCAGCCCGCGTTCACGGTTCGCCCGCTGGG
GAGTCGTGTGTGACAGTCTGGATGAATATAATCGTCTGGT
GACTCTGTGTAACGGCACCAATGAGGGATCACTGCGCAGA
GGAGCAGCGATGAGCACTAATGTGACTTTACCAACCATGA
ATGATGTGAGAAGCTGCCTGAACCTCAGAGACTTCGACAG
TCCACCGTATTTCACCAACTCCACCTTCAGCTTCCATCGA
CCTCGAAGAGAACTGGACAACAGACCGGCTATGTTTTTGC
TGGGCAGCACTCTGGGAGGAATATTTCTGGGGCTGCTCCT
GCTGTTGATCGTGTTGGTGTTGTACATTCAGCAGAGGAGA
AAACGCGAGTTTGAGCCACTCCTGAACGCTGAGTTCACAA
ACACAAAATATTCAGGGGAAGCATAACACACACACACACA
CACAGTCCCAAATCCTATGGAGCTTAAAATATGCTGAAAC
AATCTAAATTTGAACTGTGGTTATTTAAATTCTTAACTTT
GAAATGTAATAAAACTGATTATTATATGCCATTAAAA

dct TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA dct-002 1077
mRNA dct-202 (1) 1472
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dct-002 Contained in:
[Fosmid] CH1073-495O7 (1) (order this)
OTHER dct-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045983 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC098525 (1) 1468bp
    CITATIONS (1)