header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-559
Transcript Name: si:dkey-27c15.3-201
Previous Names: ch73-130m10.5-001, si:dkey-27c15.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044190 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044190|OTTDARG00000031719|ZDB-GENE-060503-728 si:dkey-27c15.3|OTTDARP00000034990 CH73-130M10.5-001 LG_ FP067441.5 Danio rerio protein_coding NOVEL, 3099 bp
ATAAGGAACAAGCTGGAACCCGTGGGATGGGGCGAAGGAA
AGGCTTGAGAAGGAAAAAAGACGCCATCAATGAAGTAGAA
GCTCAGCAGAATGAAGTGGAAGATGAAATCCAGCCGGAGG
TGGAGATTGACCGAGAGCTGGACCGAGAACTGGAGAATAA
ATCCAGACAACATAACTTAACTTCTGCAAATGTTCGAAGC
ATTATTCATGAAGTGATTACCAATGAGCACGTCGTGGCAA
TGATGAAAGCTGCTATCAGTGAAACTGAACCCATTCCTGT
GTTTGAACCCAAGATGACTCGCTCTAAACTGAAAGAGGTT
GTGGAAAAAGGAGTTGTCATTCCCACTTGGAATATTTCAC
CAATTAAGAAGCCAACAGAAGCAAAGAAGGGGCCCCAGTT
TGTGGATATTCCATTAGAAGAGGAGGACTCTTCTGATGAA
GAGTATCGGCCTGATGAAGAGGAGGAGGATGAGACAGCTG
AGGAGACTCTTCTGGAAAGTGACTTGGAAAACTCCTCATC
TTCTCCACGGGTGAGTCGAGTACAAAGATCACACTCTGAA
TCTGAGGATGGAGCCAGTAGATCCAGACTGAACCTTTGCC
GATCCAGACACCTGACAGTGGCTGCCACACCAATGGGGCC
CCCGCCGCCACCGGACACCTCCAGGGCTCCACCAGAGTGC
AGTTTCTTAGAGAAACTCCATGCTGTGGATGAAGAGCTGG
CCTTTGGAACTGACTGCATGGACTCATATCAGAGTCTCGG
TGGTGCAAGTGGAGAAGAGAGTTTGATTTCCTTCCGCACG
CGATCAAAGCGTCCACTGAGAGACGTCCCTCTGGGTCGCC
TGGAGGCGGAGCTACGGGCTCCTGACATCACTCCTGACAT
GTATGAGTTTGGCTCCGCCCCTGAGGACAGAGAATGGACA
CAGTGGCTGCAGGGCCTTATGATCTCAGATATGGACAATG
ATGAGGAGGGTGATGATGAAGACGACCCCGAGTACAATTT
TCTGGCTGACATTGATGAGCCTGATGTGGAGGACTACAGG
AATGACAAGGCAGTGCGCATCACCAAAAAGGAAGTCAATG
ACTTGATGGAGGAACTCTTTGATGCGTTTCAGGATGAATT
AGGAGGTCAAGACGACGAAGGACATGAAGAAGAGGAGGAA
AAAGAGGAAGAGGAAAGTCCCCTGCAGGAGCCGCCTGGCA
TTCTGGAGAACATTCAATATGAGGACCCATTAGCTGATGT
GTTGAAGCAGCGTTATCGGACCGTGCGTGAGCAGCTGGCA
GCTGTGAGGAAACGGAAAGCTCTGCTGGAGAGTAAAGGAG
TGTCTGTACCTCCAGCCTGCCCTCAGCGGTCCTCCAGCCC
CATAACATCCATGACCCTGAATGCAGCTCAGAGACTACAG
CTACAGCAGCAGATCCAGCAGCATGTGCAGCTCCTCACGC
AGGTGAACATGTTGAGCAGTACAGTCAAGGGTCTGGAAAC
CGAGGCTTCAACAAGCAGACAGTTTTTGTTGGAGCTGCAG
ATGTTTGGTCAGCGTGGAGAACACAACTGCGGACGTGCAG
AGCATGGCTTCTTCACCAGCATCTTCAATGCCTGCAACCT
ACAGGGTGCTGTTTCTCTGCTGGAGGAACTAGATCAGTCA
CTCAAAGGAGATCCTGCAGTCTTGAGTCCATGTTTACCTG
GATGTCAGTTTCCTGCTTCACTGGCCTGGTTGATGGCAAC
TCGCTCTGTGTTTCTTTACCCAGAGCTACTTCCTACAATC
CAGCTGCGTCCGTCTAAATTCAAAGGGCCGTTCACCTCAG
CAGAAGACTGTCTTGTTGTTCTAGGTCATAAGCACTTAAG
AGGTACCCTACACCCCCTGCAGATGACTTGTCGTTATTTG
CTTGCTACAAGGAGTTTTATCAGTGTAAAATCACACATTC
GTGATGCATGTCAGAAGCCTTTTCCTAGTGTCATCAAGGA
AACCATGGAGAAATTCTTACATCTGGCTACAAAGACAGTA
TCTGAAAAGGAAGGACGTTCAAATATTAAATCAAAGCATC
AACCTTCAGGTTCCTACTGGACTCAGACTGAAAGAAAGAC
AGTCCTTCACAATGATGCATCTGACCACGATCCCTACAGG
GATGCTAAAGATATTGCCTTTGCCCAAGCATACCTGGAGA
AGGTGTATGAGGTGCTGCATCAGGTGCCAGGCAAGGTGGA
TGAGTTTTTGTGCATTCTGTCTGATTTCGTGAAAAATCCA
GAAAGTCACACGTCACTCCAGCTGCTGATGAGACTCAAGC
CTATTCTGGAGGACTGGCCTGAACTGCTTCAGGATTTTGC
TGCCTTTCTGCATCCAGATCAAGCCCGAGAGTGCGGCCTG
CTGGCAGAGCAGCAGGCGTTTGAGCGCAGCAGAGGGTTTC
TCCGCCAGCTGGAGAGCACTTTTGGAGAGCAGTCATATCT
CTACAGAAAGGTGGTGCACATTCTACAAGGGGATCAGTCA
CAGGGTCTCGCTGATTTAAAAGAGATAAAGGCTGAAATGG
CATTGCTGCTCCGTGATCACACTGACTTGCTGGAGGAATT
CTGGGAATATTTTAAACAGATATACCCTCAAGTGCAAGAA
AATGTGGAAACAAATCAAGTCCTGGAAGAAAAACAGCCGT
CTCAGCCTAGCAGAAATATGTTAGCGGATAAAAAACTGGA
GACAGACAAAACATCAATTAAACATAGAAGAAAAACAAAC
AAACATGCTCAGATGGCAGAAATGAGAAGGAACAAGGTCA
AGAATAGCAGTGCAATGTTGGATAAGGATTCTGAAGCTTC
TTTGGGGGACAGTCAACAGTCTTTATTTAATGCCACAGGA
AGCTCTGTTTGTGCCAAAAATATCTCTCACACATCAGCTG
GGAAAAAAGTAGTCCTCTGGACAGGAGGCAGACCGTGTAA
TATTGACCACCTGTCAGCAAAGAGGAGCCAAGCAGACCAC
ATTTCATGCCATTGCAGCTCAGCTTGGCAACAAAACAGCC
AGCGAGAGCGATTTCAAGATCTCATTAAGCTGATCACTGT
CCGTCACTGGCCTGCGTCGCTTCATCAGAGACAACATGTG
AGCAGACACTCACACAACG

si:dkey-27c15.3 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA si:dkey-27c15.3-201 3099
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-27c15.3-201 Contained in:

OTHER si:dkey-27c15.3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044190 (1)
  • Ensembl_Trans:ENSDART00000138322 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE323412 (1) 855 bp
    CITATIONS (2)