Transcript

she-202

ID
ZDB-TSCRIPT-100915-317
Name
she-202
Previous Names
  • she-001
  • ch211-105c13.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046639 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046639|OTTDARG00000033216|ZDB-GENE-090915-6 she|OTTDARP00000036766 CH211-105C13.5-001 LG_ BX950871.13 Danio rerio protein_coding NOVEL, 1693 bp
CGCCAGGAGTGGATATACCGGGAATGGGATCTTCAGCGAG
AGAAAAGAAAAACTTCAAATTCTTCCGCGTTTATGCCCTT
CAGAGGCTCCTCTTTATCTTGCGGGAATAATTGGGAGCAA
ACTAAAACAAGACAATACATTCCAATGTGAAGAATCGTTG
AAAGTTTGCGCGTGTGTATGGAGAGTGGCGCAGACACCTG
TGCGTATTCGTCATGGCGAAGTGGTTTAAAGATTTTCCAA
CTAGTTTGAAGACTGGATCCGATAGGATCCGTTCAGCTTC
AGAATCGGGAACTCAGTCCCGCCCCAAGCCGGTTCTGACA
GTCGGTACTGGTTCCAAGGGGAGTCTGCGTAAAAATTCTG
GAGCGGAAAACGGTGGCGGTGGTGGCGGCGTGGGCTCGTT
GCTTCACGGCAGAAATCGTAAAAATTCTGCCATCGAGTTA
GGACGGAACCACTCCAGCACCGGCTCGATGAAAGACGGGA
AGATATGGGAAATTCTGATCCCGGGGAAAAGTAAGAAGAA
CACCAAGATGGAAGGGTTTGAAGACCATCGCACCCTGCGG
ACCACCAGCCTGGCTGATGAGTACATGAGCAGAATGATCA
AGGTTAATGATCCAAAATCCAGCCCAGGAGGATCTTCTCC
AGACAGCGAGAGGGCCAAATCACCAATCAGAACAGAACCG
ATCATCGTAGAGGATTATGCCGACCCATTTGATGCTGAGA
AAACCAGAGAACAGAAAGAAGCTGAAAGAGAAGGAGAGAA
CGATGGCTACATGGAGCCTTATGATGCCCAGCTCATTATT
ACAGAGATTCGCAGACGAGGCTCGAAGGATCTGCTGAAAG
TGTGTGTAGTGTTGAACGGAGGCGAAGGTGAGGGGTCTGG
ACCCCCTCAGATCTATGATGTCCCATATGAGGAGGTTCTG
GAGGGAATTCCGTTGACCCGACCTGAGTCCGACTCCAGAC
CGCCGGCAGAGTATGAGCTGCCCTGGGAGTGGAAGAAAGA
GCAGATTGTTAGAGCCCTGTCAGCTCAGTTTGATGGAGCC
GAGCGCATGTCGAAAGAAGAATCAGGTTCTCCTACTATAA
AACAGCAGACTCTAAGACATAAAAGCTGGACGACCAAATC
TCTACGACCGAATCCCCCCTCCCCAACCTCCCCCTCTTCC
CCCAGCATCACCCCAGACAGTGAGACCCCAATTGTTGATC
CCACCCTGCCATTGGAGAAACAGAGCTGGTATCATGGCAG
TGTGAGTCGTCAGGAGGCAGAGGCTCAGCTCCAGCAGTGT
AGGGAGGCCAGTTTCCTGGTGCGAGACAGTGAATCAGCCA
CCAGCAAGTACTCCATTGCCCTCAAGACAAGTCAAGGATG
TGTGCACATCATCGTAGCGCAGACTAAAGAGTGTGGCTAC
ACACTGGAAAAGAGCAGCTGTGTGTTTCCAAGCATCCCAG
AAGTGGTACACCACTACTGTACCCAGCGCCTCCCTTTTAC
AGGGGCTGAACACATGACCCTGCAGCACCCCGTGCCACGC
ACACACTGAACCCACACACACACACACACACACAAAAAAC
ATGCTGAACTTAAACATACCATTTTATGAAGCAAAACATG
AATCTTCAATACCGTGGTGCCAGCCAATCATATTTACACT
CTTATACTGTGTCCTAACCAGACAAAATGCGATACAATAC
CAATACAATGACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations