header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1544
Transcript Name: afp4-201
Previous Names: afp4-001, dkey-45n22.3-003, ottdart00000047640, zgc:161979-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047640 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047640|OTTDARG00000027964|ZDB-GENE-030131-5217 afp4|OTTDARP00000037413 DKEY-45N22.5-001 LG_ CR933818.11 Danio rerio protein_coding KNOWN, 858 bp
ATTATAAAAGCAGAGGGTCTTTGGAGGACACACCATCACA
TCACATCACGCCTATATCGTCACATTGACACAAGGCAACC
CTGGCTCATCCCACAATCATGAAACTCTCCCTCATCACCA
TCCTTGTTGTTGCTCTGGCCATCCGCTCTGAGTCAGCATC
TCTGGTCAAGAGAGACGCTTCTGCTGAGCTGGACAAGATC
GCCAAGTACTTCCAGGATTTTGTGGACAATCTGAAGAACG
TTGAGGGTCCAGAGCTGGCCAACAAAGCCAATGCTTACCT
GGAGGAGAGCAGAGCCCAGTTTCAGCCCATGGTTGAGAAG
CTCCAGGAGCAGCTGAAGCCCTTTTCCAACATTGAGGACC
AGATTAAACCTATTGCCGCCTCCGTCCAGGCTCAGGTCGC
CCCGCTGGCTGACATTGTCCAGACCCACATCGAGGACGTC
CTCAAATTTGTGGCTGACAAAACTAAAACCATCCTGCCTC
CCCAGTAAACCCAAAGCAATCACCATTCCTTAGTTCACAT
GCATTGCTTTTGTGTCATTATGTATATTTAAGAGAAGTAA
ATAATAATTTAAAGGTCACAGCACAATCTTGCCTTCCTTT
TTTACAAAATATGATTGTTTTTTTTTATCTCACTAGTATT
AAATAAAGAAGCCATTTTGTTTTTCTTGTGCTACTGCTGA
AATAAGGGAAACATCTAAGAAAAAAAATCCTGATATTTTG
GAGTTGATTGTGAAAAATACAAATACAAATATTTAAAATT
ATTAATACATAACCTAAAACACTGCATAACAGATAAAATA
TGAATATTGTTTTTAATTCTCTAGATATGAGTATCCAATA
AAATGTTTATAACAGGAA

afp4 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA afp4-201 858
afp4-202 (1) 603
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
afp4-201 Contained in:
OTHER afp4-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047640 (1)
  • Ensembl_Trans:ENSDART00000133213 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC153962 (1) 881bp
    GenBank:EH585498 (1) 607bp
    GenBank:EH611381 (1) 591bp
    GenBank:EH579514 (1) 580bp
    GenBank:EH597772 (1) 561bp
    GenBank:EB964788 (1) 535bp
    CITATIONS (2)