ZFIN ID: ZDB-TSCRIPT-100915-1527
Transcript Name: snx24-201
Previous Names: snx24-001, ch1073-230p18.5-001, zgc:114136-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047384 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047384|OTTDARG00000033661|ZDB-GENE-050913-45 snx24|OTTDARP00000037230 CH1073-230P18.5-001 LG_ CU633977.7 Danio rerio protein_coding KNOWN, 1452 bp
GCTTACATTGCTTATTTCTCACAAAAATTTCTATGACTGA
GAACCTCACCCTCTTTGTCTAATAGATGGACAACCGACCA
AATACCTCTTTCCCATGAGTAAATATTCATTTTGGGGTGA
ACTTTTTCCTTTAAGGTAGTTCTGAAGACCAAAGGGGAAT
TCAGACCATCAATATGTACCTTTAAAGTATAAAGTTAGTG
TACTCAATACGATACTAAAACAAAGACAACAATAACTACA
CATAAATCTATCAATACCGGTCTTAACATATTTATAGATC
AAATACCCAGCTACAGATAAATAACCGCTGGTGGTAGTAT
TAGTGTTTGAGGCCTGAATTTGTCTCTGTCAGAGCGCTAG
ATGGCAGCGTTACATCCTCAAACCCACAGCTGAACCTCCT
GCTGCCGATGGAGAAGAAGCGCCTGAATATCTTCATTCCT
GCTCATGTCAGGCGGCCAGTCAACTTGACAACCAGAAGAA
ATACACCGAAGGACCAAGCAAACATCTCCTACAGTTATTT
TATCGCTTTGCTGCGAAACAACCGCCACATCTCGCCGTAT
CATGCATCACATAGAAGTGTCAATCCCGTCTTTTCGGTCG
GAGGGCAGTACCGTGGAGAAGGGATACACGGTTTTTAAGA
TCGAGGTGCTCATGTGTGGCAGACAGCATACTGTTGAGAA
ACGATACAGTGAATTTCACGCGCTTCATAAAATGCTTAAA
AAGATAATAAAACCTCCAGAAATCCCTTCAAAACATGTGA
GGAACTGGGTTCCCAAGGTTCTTGAGCAGAGGAGACAGGG
ACTCGAACTCTACCTTCAGACTATAATCATGGAAAATGAG
GTTCTTCCAAAGATATTCCTGGATTTCCTCAATATCCGCC
ATTTCCCATCTCTGCCAAAAACTGAAAGTTGTGGATCATT
TGAAACAGAATCGGATGAATCAAGTAAACTGACACATCAA
CCAGCACTTCTCTACCAGAGGGATCCATATCTGCTTCCTG
CCTCAAATGATACATTTTCCAATATGGTAATCGAAGGTGT
GATACGTGGAATATTTTACCCAGATTTCCAGCCGAGGTAG
ATCTCAGCACTACAAACAACATCACGGATTAAAAAAGGGA
TTCAACACTAACTCTCACAGCACCAGTTTAACAGACTCAC
TCAATGCAGCCTTAAGAGTGTAGTTTGGTATCAACACTCC
TTGAGATTTTGCTTTGTTAAATCCAAAATTAGTTGTGCGC
ATTCAAATCACTTATCAAATCAAGGTCTCATTTAATATAG
CAGAAGTACCTCCGCATATGTTTGCACTTCTCTCCTGTGT
CATATATTGAGGTCAGATGAATATCTGATCTCCTCTGACT
GCATTTCTGCAGATTAGCTAAACTATAAGTGTTGGAAGAG
CCTTGAACATTTTCATTATGTTATTGAATTATTGCATAAA
CGTTATTTTCTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
snx24-201 Contained in:
[Fosmid] CH1073-230P18 (1)

Genome Resources: Vega_Trans:OTTDART00000047384 (1),  Ensembl_Trans:ENSDART00000075563 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC097192 (1) 1072 nt
GenBank:EG571199 (1) 911 nt
CITATIONS (2)