header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-152
Transcript Name: dct-202
Previous Name: dct-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045982 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045982|OTTDARG00000032848|ZDB-GENE-000508-1 dct|OTTDARP00000036283 dct-001 LG_ CU694472.5 Danio rerio protein_coding KNOWN, 1472 bp
GAAACTTTGCCGGCTATAACTGTGGCGAGTGTAAGTTCGG
CTGGACGGGGCTGAACTGTGACCAGCGTAAAGCTCCGGTG
CTGCGGAAAGACATTCACTCTCTGAGTCCGGAAGAGCTGC
AGGAGTTTCTGAACGCACTGGATCTCAGCAAAACCACCGT
TCATCCTGATTATATGATCGCCACACAGCACTGGCTCGGC
CTGCTGGGACCCAACGGCACAGAACCACAGTTCAGCAACA
TCTCCATATACGACTTCTTCGTCTGGCAGCATTACTACTC
CGTCAGAGACACGCTTCTGGGTCCTGGACGTCCTTTTAAA
GCCATCGACTTCTCGCACAAAGGCCCAGCGTTCATCACCT
GGCACAGATATCACCTGCTCAGCCTGGAGAGAGAACTACA
GAAACTGACGGGTAATGAGAACTTCGCCGTGCCGTACTGG
AACTTTGCGACAGGCCAGTCAGAGTGTGACGTGTGCACAG
ACTCTCTGCTGGGAGGACGAGACCCCAGTGACCCATCCCG
AATCAGCCCGCGTTCACGGTTCGCCCGCTGGGGAGTCGTG
TGTGACAGTCTGGATGAATATAATCGTCTGGTGACTCTGT
GTAACGGCACCAATGAGGGATCACTGCGCAGAGGAGCAGC
GATGAGCACTAATGTGACTTTACCAACCATGAATGATGTG
AGAAGCTGCCTGAACCTCAGAGACTTCGACAGTCCACCGT
ATTTCACCAACTCCACCTTCAGCTTCAGGAATGCACTGGA
GGGATATGATAAGCCGGATGGAGAGCTGGACACATCAGTG
TCCAATCTACACAACCTGGTTCATCAGTTCCTCAATGGGA
CCAGCGCTCTGTCTCACTCCGCTGCCAATGACCCAATATT
TCTGGTGCTCCACGCATTCACCGACGCCATATTTGATGAA
TGGATGAGACGCTTCCGTGAAAACGAAACTTTCCCGGATG
AAATGGCTCCAATCGGACACAACAGGCATTATAATATGGT
GCCCTTCTTCCCACCTGTGACCAATGAGGAGATTTACATC
GCATCTGAACAGCTCGGATATTCATACTCCATCGACCTCG
AAGAACTGGACAACAGACCGGCTATGTTTTTGCTGGGCAG
CACTCTGGGAGGAATATTTCTGGGGCTGCTCCTGCTGTTG
ATCGTGTTGGTGTTGTACATTCAGCAGAGGAGAAAACGCG
AGTTTGAGCCACTCCTGAACGCTGAGTTCACAAACACAAA
ATATTCAGGGGAAGCATAACACACACACACACACACAGTC
CCAAATCCTATGGAGCTTAAAATATGCTGAAACAATCTAA
ATTTGAACTGTGGTTATTTAAATTCTTAACTTTGAAATGT
AATAAAACTGATTATTATATGCCATTAAAATGGTTTTGAG
TTTGAATTTCTTAAAACTTATATAATATATTGTCAATGCT
GTGTATCATATTATTAAAAGTTTGATTGTTTA

dct TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA dct-202 1472
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dct-202 Contained in:
[Fosmid] CH1073-495O7 (1) (order this)

OTHER dct-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045982 (1)
  • Ensembl_Trans:ENSDART00000145138 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC129260 (1) 1884 bp
    GenBank:AF280090 (1) 1742 bp
    CITATIONS (2)