header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1466
Transcript Name: plekho1b-201
Previous Names: ch73-70i4.1-001, plekho1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047095 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047095|OTTDARG00000033488|ZDB-GENE-100609-2 plekho1b|OTTDARP00000037047 CH73-70I4.1-001 LG_none CT025591.5,BX005412.17 Danio rerio protein_coding PUTATIVE, 6060 bp
ACCAGAACTCCACGCGTGACGGCAGAGGATCAACAACGCA
CGAGGATGCCACTAACACACACTCACCAGCACATTTCTGA
GGTCTGTCCGAAATAACCAGCAAATGGTGACCGGCGCGGT
GGACGCTGAACGGGAGTAAATTCACCGGAGGAGGCGTAAA
GAAACAACCGGGGAGCGACTCTCATTTAACAAAGCGCTTT
TCTTTGAGTGTGGCTTTTTCGGGTGTAGGATTTTCAGTGG
ATTCTTTTGTATCTGGATTGTTCGTGGAGGGAGAGAGCCG
GGAAGCGGTGTTTCATTGAGCCATGAAGAAGAACAGTTCG
TCAAAGCGGGGCCCTCAGGATGCCAATCAACAGCCTGTGC
AGCCCGACAAAACTGGCTGGATCCGCAAGTTCTGTGGCAA
AGGAATTTTCAGGGAAATTTGGAAAAACCGATTTGTTATA
TTGAAAGGAGACCAACTCTTAATTTCTGAAAAAGAGGTAA
AAGATGAGAAGAAAATTCAGGAGGTGGTGGATCTCACAGA
CTACGAGAAGTCTGAGGAGCTACGTAAGGCCAAAAGCAGG
AGCAAAAAGAACCACAGCAAGTTCACGCTTCTGCGTTCAC
GGCAGCCAGGCAACACGGTCCCAAATCTGGTGTTTCTAGC
CGTCAGTCCAGAGGAGAAGGAGTCATGGATCAATGCGTTA
AATGCAGCCATTACCAGGGCCAAGAATCGCATATTGGATG
AGGTGACGGTGGAAGAGGACAGCTTGTTGGCCCATCCGAC
GCGTGACAGAGCTAAAATACCCCACACTCGCCGTCTGCCC
ACCCGCGGGCACCTCATGGCCGTGGCTTCTACCACAAACT
CAGACGGCATGTTGACGCTGGACCTCATCCAGGAGGAGGA
CGTCCCAGCAGAACAGGGTCAGGCCTCTGGTGAGGATACT
GTGGATAAAGCCTCATCTCAGCGTTCCCCAGATTCCCAAC
CCTCCAACACGGACACCTCCAAGCTGTCATGCTCCAACGA
GATTGCAGGAAAGTCCCAAAGCCTGCCGCGGAAAAGCGAA
AGCGCCTTCGACTGGTCGGAGAACCACCGGACGCCACAGC
TCCGCAAAAAACCAACAACATCTGAGAAGAACCGCTGTGC
CTCCATGGACGAGATTCTAACGCACTGCGAGGCACGAGCT
CTTCCTCACTGCTCCACGTCTGCACCCGTGCAGCCCATCA
GCCAGCTCCAGGACCTCATCACACTGAAGCTGGAGAGAAC
TCAGGAGCTGCTGACCGAGGTGCGGGCGCAGGGCAAAGGA
AAGGGCTCTCCGGCTGGGAAGAGCTCCAGTCCTGAGGGCA
AGCGGAAAGAGGCCGAGCGGCTCCTAGAAGAGGCCGCATC
TACATGGGGTCAGGCTCGGGACGTCTTGGAGGAAGTGAAA
GAACTCCGAGCTTTATACAAGCAGCTTGACTCTTCTGCCA
CAATCAGTCCAACACAGAACGGCAAACTGAACAGCCCTCA
ACAAGCCAACCACCGAAAAAGCATGATGTGAGGTCATCTT
TCAATGCACTCTTCCTGCTTTAGCATTGCTGGAATCAACG
AACACCATGAGCTTTACCTGTATGTACGAATTGTTCAAGG
GCAAATCTAGTTTCTTCCACTCCCTTATATCAACAGAAAT
CCAAGGGCCGGTGGGTTTTTACGCAAACACAAACTGTTGC
GCTATATCGGTTTTCACAGTGGTGTCAACGGGGGACTGTA
AAAGCTTCAGGGTGAGAAACAGCAGATGGCGGTTGTCATC
ACCAGTCTTTCGCAATGTGAATGTTTTCATAATACACTGG
AGGAGCTTAGTTTAGATCTGGCCAGGTCTGTTTTACTCCA
TGGGTCATTTTTGTATGTAGTAATAATAATAATAACTCCC
AGCACACTTGCTCTACTGTTAACACAATCCAAGCTCATAA
TAAGATGCAATCAGCCAAAGGCGGATTGGCGGAAAGGCTC
ACGGAAAGAGCACTCGTCACATGGGCTCTTAATAGTGAAC
AAAGCCATTGAACATGAACACAGATGACGTCTGGTGCCAG
TGTTGAAGAAACAGCTGCCATTAAAGACGAGGCTCCATGC
AGTAAAGGAAAGGATGAATAATAATTAAACATTTGCACTA
TATGGAGAATGCTGTAAAACGAGAGTGACACTGGCAAGCT
ATCTTTTCAAACCTAAGAGGCAGAACAGACAATCTACTGT
AGGGAAATATGGGTCGTGTAGCTCAAAGTCTTTACACCTA
AGTGGTATTTCCGAAAAAAAATGTTGGTATCTTTGGAAAT
CAAAAGCTGCCTTAGAGTATTTTCAAAAGGGCACATGCAA
ACTGCATTTTAAACTCTGCAAAGTCTCTGAATGAACGCTT
GTATGTTTCAATTTTCAGAAATTTGCCTACAAGTTGCCTG
CACCGCGAGAGATGCTTTTAAAGCAGGATTTTATTATCGC
TTGCGCTTTGCTTTGCAGGCTTTTTTTTGTCTTTGGGGGA
ACTATGCAAGGTTGCATGGGAGAATCTCATGAAACTTGTC
AAGAGCATTTCACAGAATTTTTTTTACAAAGAACAGAATC
TATATTTCCTTAGGAAGTAAATGCAGGAATTTTATTTTTT
TGCATATGTATTTTTTTATTTTACGCCATTTGTTATGGAC
ATTTAGGCCCAATCCCAATTCTACCCCTAATAGGGCTGTG
CGATTTGGGGAAAATATCTAACTGCGATTTTACTACAGAT
TTTGTGATTGCGATTTAATTTTATAATCAAGATTCGGCTC
AATAATATCTATCGTTGCTCCTTACTGCAGTGAGTGGTAG
TTAAAAACAGAAAATGAAAACATATAATCTTACGCCAACA
TTTACTTCAAAAGTTCACACTTAGCTGATGATTGATTATA
AAGCTTGTTTGTCATGCTGTCCTGGGAGAGACCCCTGAGC
TCATGAGCTCCTCGAACCCGGGGCTCCCATCCTGTTTGCA
GGGCGAGAGGGGAGTTTGAGCTCAGGTAGATCTCCAGAAC
TCCCCTGCTGTCGTAGCTAATGAACAGATAGTGATTGCTC
TTAAGAGATAACTACTTACTAGGAGCATTTGGATTAGTCA
ATTAACTCAAGTTGCATGTTTTTGGATGGTGGGAGGAAAC
CGGGAACCCCAGGGCAACCCACATAAGCGTGTGGGGAGAC
TTGTAACCCCGCACAGAAATGCACAGCTGGCTTGGTAAGA
ACTAGAACCAGTGACGTTCTTGCTGTGAGGCAACAGTGCT
AACCGCTGGGCCACCATGCCACCCATCTAGGAAAGGAGGA
GGAGTAGGGGTGGAAAGGAGGATTCTTCATAACGAAGATG
GCTGTTATATGGACATTAGGGTATTTCAATCGTCTAATTG
GTAAATCATAAATTGAATAATGCAGGACCAGCTGTAAGCA
ATCATAAACATATGATCCTCTCGAAATTAGTTTATAAATA
AACTTTACTAGATCGAGTGTGACTAGCAATACTATCAGTT
GATTTTTTAGCAAGACACTCCTCATATACCTATACGCATC
TGTGGTGCTTTTTTAAACCACAATATTCCATATTACTGAC
GTGTGTTTTTTCTTTGATATGAATTCGTCTGTTAATACTT
CTGAAGCGGTAAACACCATCATCCCACTTGTTTTTATTAT
TGTGGGTGTTCCATTTAGTGCGGTTGCGCAATTTTGATTG
GGCAGAATGAATGTGTCCTCACTCAATTGGCTAGTAAGAC
TGTCACACACAGATGGCAGTCACGCTTTTGCTCTGGGCAG
GAGAAATTAAATACATATATATTTCAAATCGCAGCATCTT
GTGATTAGCAAATTGCCAAATTTCAGATTGCATTGCGATT
AATCATGCAAGTTTTGCGCATTCACGTGAAGGGGTCGGGG
TGTCCCAATTCTCTTTATCTTGAAGGCGTAGGGCTAAGGG
GAAGGGTTAGAAATCCCTTAAAACAGAGATTTTTCAGGAC
CACACTATAAACCAAGGAGTACGAACATTTCCCAGAATAT
CTATAACGACAGCATGGCTGCACACGGACGTCAGGAGATG
CACAAATTAGTATTTTTGTCATTATTAAATTTTTCTACAA
CAAACAGGCATATGTGTTAATACATTCATAACTGCGTTTG
TGTTTTACTGTCATGCTTTGAAAAAAACTGCTAAAATAAA
AACAGCTAACATAAAAACCCATCTATAATCCCTAATAATA
ACTCCTGTATAGTAGTCCAGCAACATTCTGTCACTCGATG
ACACTTAAATACTCTGTCAGAAAAGTCTATTGGCTGGGAA
TGAGCTTTTTACAGTGTCTGCTATAATCTTAATGTTGTTT
TCGTGTATTTACATTAATGAATATGATCACGGTGTAAATG
CACAGTACAGTTACATCTTTTTGCCACATTATATCGATAT
AATAACATGGTATCGTTGCCTTCGGTGATTTCCTAACATA
ATAAACACCAAAAACATAACACAACTTTAATAACTACAGC
AGTCGCCATCATCAATGTCATATGTAGTACGAGCTCCCTA
TGACATATGATGACGTGTGCAGGTGTAGTGGTGTCCCATT
TCTTAGGGGTAAACTTTGAAGCCCTTCCCTTCACACTCTG
TTTCAAGAGCCAAGGGGAAGGGGTACAAAAATAGAATATG
GATTGGGCCCTAATGATAATGGTCATGCAGAATTCAGTTT
CTTTATGCAGTTCGGGCAGTAAAATGTGGCATGCTTTCAT
GAGATTCCCCCACAAAAATGAGCTTGAAATAACCCACAGG
AATCAGGAGTTACTGGCAGTGTGCAGTACGCTATTGCATT
CAACAACCAAAGGGTACGTCTTGCCAGTATAAAAACCACC
TTGTTTTACAGTTAGTAGCTAAATAATGTGTTTGCACAAT
TCTATTGGTACAGGTCAACCTGTTCTGTTACGAAGACTTG
ATTAAAAAAACAGTGTTATATTTTTTGTACATTTTATTGT
AAAGTGCTTTTTTTGTTTTTGTAGAGAAAGACTTTGAGGA
GAGTTTTTGCTTTTAAAACGTTTGACTTCCCTGAAAACAC
AACTGGACACTTCCTCGCTTCTGGAAAGTACATTTACGCT
TCCAAAGGTAATAAAGCACAAAGACGGTCATTTTGTTTAA
GTACAGGTGAACGCTTTAAATGTCATTCATTACCCCTCTC
ATTTGAAATTCTATTGTCTCGCATTATCGCCACGCAGATG
CCAAAGGTTTCCTGTACCTCGCACGTTCTTATCTGAAACA
CAGCGCTGCAGTTGTGGGATCTTTTCAGGTTTAATCAGAT
GAATTGCTTTTGTTTGGTCAGCTGCTGGTGTTATGATCTG
ATTTTTCTGACAGCGCCAGCGGAAGGTGAATCGAATTACC
CGAGCATCTGTCAGGTATTAGATTACATAAACCCAATCTT
TCCCACAGGAGAACAGAAACAAAAGCCAAACTACACCTGT
ACTTCAGCAGTTGTGCTCATTTACGACATGTTTACTTCAT
GTTGACTTTGTGATTGCTTAGAGATGACGCTTCCTTCACG
CTTTTACTTTTGAGCTATTTATGTATGCCATACGATTGTT
CATCCGCTCTTTTTGTCGTTTGATAAAATGTGAATGAAGA
GGAAAATCTCTCTGTGTTATTGTGGTCAGACTAGTTATTT
TGCATAGGGACGTTTCATTTGTGAGCTAGTGCGTCACACT
GCCACTGGCGCACACAAAAAAAGGCTTATGTAATCAGAAA
GGAACAAACAATTGATTGTACCATCGAGTCGGCCATTGAA
AACCTGAATGTTTTCAGCATTTTTTCAATTCCGTTCTACA
TAAACACATGCAATCTCTCAGATGGACGCTTCATTACAAG
CTGCTGGTCAACAACTCAGATACTCGTTTTCGAATCATGT
TCAGATGGACGGTTGTAAAAATCTCTGTGTACATTATTTC
ACATTCTGTAGCTAATTGTAAATGGTGGTCGGTTTTTGAA
GAGCAGAAACCTGTATGTGGCTATTTGTAAGCTCAGGACA
GGAGAATCTCTGATGTACTTGAGACACAACCACTTGTGCA
ATTAAAGTGATCCTCATTTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
plekho1b-201 Contained in:
OTHER plekho1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047095 (1)
  • Ensembl_Trans:ENSDART00000114266 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT678339 (1) 842bp
    GenBank:DV597085 (1) 709bp
    GenBank:CK361216 (1) 610bp
    GenBank:EE214790 (1) 512bp
    GenBank:AW826961 (1) 369bp
    CITATIONS (2)