Transcript

col6a4a-201

ID
ZDB-TSCRIPT-100915-1460
Name
col6a4a-201
Previous Names
  • col6a4a-001
  • dkey-202m9.3-001
  • si:dkey-202m9.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047064 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047064|OTTDARG00000033467|ZDB-GENE-041111-303 col6a6|OTTDARP00000037030 DKEY-202M9.3-001 LG_ CR942305.18 Danio rerio protein_coding NOVEL, 8669 bp
GATGCCAGGATGAAAATCCCCCATATGACATTGTATTCCT
TGTGGATAGTTCCAGCAGCATCGGCACGCGGGACTTTCGC
GAGGTAAAGACGTTCATGCACACGTTTGTGGACGGTTTGG
AAATTGACACCAAAAAGGTACAAGTTGGCGTTGTTCAGTT
CAGCACGGATCCCCACAAAGAGTTTCTGCTGGGGGAATAT
GCTAACAAAGCGGAGCTGTTTAGGAAAATAGACAACCTTC
CATACCGAACCGGAGGCACGTATATGGGAAAAGCCATGAA
TTTCCTAAAGGACAATTACTTCACAAGTGCTGGTGGAAGC
CGTGTCAGTGAAAAAGTGCCTCAGGTTGTAGTGGTGATCA
CAGATGGAGACTCAACCGATGATATAAAGGGACCAGCTGA
AGATCTGCGAAAGAAGGGTATTATCATTTTTGCCATTGGT
GTCGGTTCTACCAATATGACCGAGCTGAAGGCGATTGCCA
GCACCCCGCCTGAGCGTTTTGTGGTTAATATTGACAACTA
CCAAGCATTGCAAGGACTGACGACCACTATGAAGGAGACA
GTGTGTGTCTTAATGAGGGATCAGGGGAAAGCTCTGGCCC
CGAAGTTTACTGATGTATTTGTGTTGGTGGACAGTACAGC
TCAGGGGGAAACACAGCAAATAAGGGAACTTCTCAACCGA
CTGCTTGTGCAGCTCAATGTGGGTGACGGATCTAATAAGA
TTGCGCTGGCTCAGTTTGGTGAGAACGTCGTCAAAGAGTT
CCTGTTTAAAGACTACCAAACAGCGCAGAAAGCCAGAGAG
TTCATAAATCGGTTCGAGCCCAGGCTTAATGGAGAGCGAA
AATTGGGAAAAGCCATAGATTATGTTCGCACAAATTTTCT
GAACACAGTATCTGGCAGCAGGATCGCGAAAGGCTACAAG
CAGTATCTGCTGGTGCTGAGAACTGGAGACTCTTACGACT
CTACTGTGAGGGCCATACGAACAATGAAGAATGAGGACGT
GTCCGTCATTGATATCAGACTGGAACCAAATTTACAATCC
TTGTTCCCCTCACTACGTGCCTTCCAGATCGACCAAAATG
TTATTGATGTGGCTGCTGACGTCACAAAAAGAATTCAGGA
GAAAGAGGTTTTCAATGTTACAGGAGATTGCAGATCAGCC
CAAGTGGCGGATATTGTGTTTATTGTGGACGAGTCAGGTA
GTATCACCCGAAACAATTTTGAGCTGATCAAACGTTTTCT
CCACCGTATTATCAGCGGCCTAGAGGTGAACTCTGACAGC
GTGAGGGTGGGAATGGTGCTTTATAACGACAGACCCAGCG
CCGAATTCTACCTGGACACGTTTGCTAACAAGAACGATAT
TATGAACTACATTAAAATCATTCCATACAGAGGTGGAGGA
ACAGCAACCGGTGCAGCCCTAAAGTTCGCCCAGAACAATC
TGTTCACTCAGAAGAGGGGGAGCCGGAAAGCTCTGGGTGT
TAAGCAGATTGCCATCGTCATGACTGATGGCGAGTCCGAG
GATGATGTCACGACCACAGCTGCTGAACTGAGGCGCTCAG
GAGTCACCGTGTATGCCCTCGGAGTGAAGAACGCTAGTGT
GGAGGAGCTCAAAAAAATCGGATCCTACCCAGAACATGAG
TTTGTGTTCAATGTGGGAAGCTTCCTGATGCTTTCATCTC
TGGAGAAGAGCCTCAGAAAGAGTCTGTGTAAGGTGGTGGT
CAACAGACGATTTGACAAGAACAACAGATTGCTCCTAAAA
CAAGGATGTGTGAACACAGAGGAAGCAGACATTTATTTCC
TGTTGGACAACTCTGGCAGCACTCGCGCCGACTTTGAAGA
TGTGAAGAAATTTATCTTAGGCTCCCTTCAGTTATTCAAC
ATTGGACCAAATCGAGTTCGTGTAGGAGTTGTAAAAGTCG
ACCGCAATCCCACTCTTCAATTCAGCCTGACAGAGCACAA
AAACAGAGCTTCTTTTGAAGCAGCCGTGAGGGGAATCAGT
CAGCCTGTTGGAGGCTCAGAGAAAGGCAAAGCACTAAAAT
ATGTGGCCAGTCTCTTTAATCAGGCTAAAGCATCCCGTCC
AGCTAAAGTGCAGGAGATTCTCATTGTCATTACTGATAAG
ACGTCTCAAGATGATGTGGGGGATCCAGCAGAAGAGCTGA
GGATTCAAGGGGTTTCGGTTTATGCCATTGGAGTAAAGGA
TGCCAGCCAGGATGAGCTCTTGAAGATGACGGCTGATGAA
ACTAAGGATTTCTATGTGACCAACTACGATGCCCTGAATG
TTCTCAAGCGAGAAATTGTCACAGATATTTGCTCTCAAGA
GGCCTGCAAGAACAAAGTGGCAGATATCATGTTTTTGATT
GATGGTTCTTCCAGCATTTATGGCCCAGACTTTACATCAA
TGAAGACGTTTATTACCAAAGTTGTAAATGGGACCATCAT
CGGAGAAGACAGTGTGCATGTTGGTGTTGTCCAGTTCAGC
AATAACCCACAGGAGCAATTTCCCCTGAACAGGTACTTTG
ACCAAAATGAATTAGAAGAAGCAATCGACGGCATTGAACA
GTTAACAGGAGACACATACACAGGGAAAGCACTCTCGTTT
ATTTCAAAGTATTTTGATGCATCTAATGGCGGTCGGCCAG
ACGTTCCACAGTTCCTGGTGGTTATTACAGATGGAGAAGC
TCATGATGCTGTCGCCGTACCTGCAAAGGCCATCAGAGAC
AAGGGTGTCACCATCTTCTCCATAGGTGTGGCCAGTGTAA
ACACCACACAGCTATGGGAGATCAGTGGTACTCAAGATAA
AGTGTATGTGCAGAGGGATTTCGATGCGCTTCATTCCATC
GACAAAAACCTACAATTCAAGCTCTGCAGCTCTCACCCTG
GCGGTTGTCCTAGCACACAGTTGGCGGATGTGATCTTCCT
AGTGCAGTGCACCAGACAAATTCGTCTCCAAGATTTTGAG
AAAATTAAAAGCTTTTTAATTTCTGTGGTGAATAGCACAC
AAATTGGGGATAACCTAATTCGCTTTGGAGTTATCGTCTA
CTCTGACACGCCGAGTCAATTCTCCTTAAATCAGTACAAC
ACTAGACGTCAAATAGCGGAAGCCATAACAAGCCTGAAGT
CTCCAGCTGTAAGCGGATACACGGCTAGGGCTCTTGCATA
CTCTCTAACTTACTTCACTGAAGCCAACGGAGGACGCCAA
AAACGAGGAGTCCCTCAAATGCTGTTCATGATCACAGATG
GTGATGCCAGAGACCGAGAAAACCTGCGTGCAAGGGCTGA
TGAGTTTGCAGCCAAACAAATAAATGTGTATGGAATTGGA
GTGGCTAGAGCTCAGGATAGTGAGCTGGAGATTATTACCA
AGAGCAAAAACAAAATCTTTCATGTTAATAATTACGACAA
CCTTCAAGATCTGCAGATGAATGTCTCAGGTGTGCTCTGC
AATGCAACCAAACCAGTATGCCAGAACGAGGTGGCCGATC
TTGTGTTTTTGATTGATGGATCTGAAAGCATCTCAGAGGA
GTCGTGGATTACAGTGATTGCTTTCTTGCTAAATGTTGTG
GACAAGCTTCGTATCGGTCCAGAACTTTTCAGAGTCGGCA
TAGCCCAGTTCAGCAGCGTATATCAGAAAGAGTTCTACAT
GAATGAGTACAAAGATGCTGATGGGGTGAAATCAGCAATT
CGACGAATCACGCAAATTAAAGAAGGGACGCTTATTGGGA
AAGCTCTAAGTAACGTTGTGGAATTCTTCCAGGAAGACAA
AGGGAGTCGCAAACAGAGTGGCGTACCGCAGAATCTTGTT
CTCATCACTGATGGCGTTTCATCGGACAGAGTGAACGAAG
CAGCTGATCAACTCAGAAACCTTGGGATTAACGTCTTTGC
GATTGGAATTGGAGCTGTCTCATTGCAGCAGCTCAGCTAT
ATTGCCGGCTCACCGGACAGGTTGTTCAAAGTACAGAACT
TCAACTACCTTAATCTGACAACAGCTACGTTTGTTGATGC
CCTTTGCGTTCCTTTACCTTTAGCACAAGCAAGTTGTACT
ATTGACATTGGCATTGGATTTGATAACTCCCGAACCAGTT
CAAGTTCTCGCTCAATCTTTAGAGACCAGATGAAGCTGCA
GACGTACCTGCCCGAGATCATCCGCTCCATTTCAGAAGTT
CACAACCTGTGCTGTATTACTAAACCAACCATCAAAACCA
ACATAGGCTTCAGATTGGTCGATGCTACAGGAAAAAGGCT
GGATGATTTTTCTTTTGAAGAGTATGATGTAGGAGTGTTA
AACAAAGTGATGGCACTTCAGACATCCCAGTCTCTGAAAT
TCAACAACCTGCTTCTGCGCTCTTTTGAAGAGAAGTTTAG
AGCTTCGAATTCTTTTGTAAAGGTGCTGATCATCTTTACA
GATGGGTTGGATGAGCCTGTTGAGAACCTTTTGTCTACTG
TCAATAGCCTTAGGACAAATGGTGTAAAAGCTTTGTTGAC
AGTAGCGCTGGATGGATATAAAAGTACAACTGACCTGCAG
AGGCTGGAGTTTGGTCGAGGGTTGCGCTATAAGCAGCTGC
TCTCCATTGGCATGCAAAGTGTGGCCAGTGTCATGCAGAA
GGAGATTGATAACATTGCATCGAGGGAGTGCTGTAATGTG
GCGTGTAAGTGCTCTGGTCATGAGGGATCTCGTGGTTTTC
AGGGACTGCCCGGGTCAAAGGGATTACCAGGACGGAGGGG
AAATTCTGGCTACCCTGGAGAAGAAGGAGGACATGGTGAG
CGAGGGCTTCCTGGTTTGAATGGAACTCGAGGTAATCAGG
GATGCCCTGGAAGAAGAGGCTTAAAGGGTGGCAGAGGTTA
CAGAGGTGAAAACGGAGAAGAGGGAGATAATGGATTAGAT
GGGGTTGATGGTGAACAGGGTAAAACTGGAGCACCGGGAA
GTCCAGGAGAGCGAGGAGATCCAGGCAATCCGGGTCCAAC
AGGTATTTCAGGAAGCTCAGGAAGCCCAGGACAACGAGGC
CTGAGAGGAGATCCGGGTAATTCAGGATTGGATAACAATG
CCCGCGGTCGTAAAGGTGATGCCGGCAGTGCAGGCATGCA
GGGTGATCCAGGCCCAGATGGTCTTGCTGGCCAAAGTGGA
GAAAATGGCAGACCAGGTCAATCTGGCAGAAGAGGGACGG
CAGGTCTACCGGGTCCCAGAGGGCCTCCAGGAGATCCAGG
TTTACAAGGACTTCCAGGGGGCTCGGGTCCACAGGGCCCT
TTTGGTCCTCCTGGTCCAGTTGGGCAAAGAGGTTTTGTTG
GTCTGCCTGGACCTCAGGGATCGCCTGGCTCTCCAGGGAG
GCCAGGAACTAAAGGAAGCCTTGGATCCAGAGGACAGAAG
GGTCAACCAGGTGATCCTGGAGAAAAGGGGTCTTTAGGGT
CTGCAGGTTCCAGGGGACTGCCGGGAAAAGATGGCAATGA
TGGCTATGGATATCCAGGACTCAAAGGACAGAAGGGGGAT
TCTGGTTTTCCAGGATATCCTGGACTTCAGGGTGAATTGG
GCTTTAAAGGCACAAACGGAGGTGTTGGTCCTAAAGGCAG
CAGAGGAAGAGGGGGCAATGCTGGTAGGACGGGACCACCA
GGAGATCCTGGCAGTGGGGGGATGACTGGACACAGAGGCC
CGAAAGGACCACGAGGAGCCAGACAGATGTCTGACTGTCA
GCTGATCTCATATGTTCGAGACAACTGTATGTGCTGCAAA
GACAACATAAAATGTCCGGCATACCCCACTGATCTTGTGA
TTGGCATGGACATGTCTGAAGATGTGACCCCTCAAGGCTT
TGAGCGCATGCGTTCTGTGGTCCTCAGACTGCTGGACAAC
ATGAAAATTGCAGAGAGTAGCTGCCCGACAGGGGCTCGAG
TGGCTCTGGTGTCCTACAGCTCATTCACCAAATACCTGAT
CCGCTTTAACGACTACCACCGCAAGAAGCAGCTTATCGAT
GCCGTCAACAACATCGCCCTGGAACGCACTTCAAATCGCC
GCAACATTGGCGCTGCCATGCGGTTTGTGGGCAGAAATGT
TCTGAAGCGAGTGCGAAAAGGCATCCTGATGAGGAAGGTT
GCCATTTTCCTCACTGCTGGAGAATCTCAAGATTCGATAT
CTCTCACCACTGCCATTCTAGAGTACAAAGCCCTGAATAT
TAAACTTGGGGTCATTGCTCTGAGGAATGTCCCTGCTATC
AGGAGAGCTTTTGAGGCAGATGAGAGCCAGAGTTTTATCC
TGACTGTTCTGGGTAGAGTGCAAGACCAGAATGCTACTCT
TAGTAAGATCCAGAGTTGTGTTATTTGCTATGATCCCTGC
AGACCAGCTAGAGAATGTGAGGGCACCAACCTGCCATCTG
CACCTCAGGAGCTGGACATGGACTTTGTGATGGTTGTGGA
CGGGTCCCGTAGCATCCTGGCTGACGAGTTCAAGGGTGTC
AAGGAGGTGCTCGGCGGTGTGCTCGATCAAATTGTTGTGA
GCAGTCAACCCACCAGGGCTGACAGACAGGCCAGAGTGGC
TCTCTACCAGCAGACGTCTACCTATAGTGACCCCCAGCCT
GCACACGAGATATTCAGCTTACGTGAGTTCTCTGATCGCA
ATCTAATGAAGACAAGCATCATCCAAAAACTAAAGCAAAC
CGGAGGATCTCATGAACTGGGTTCTACTTTGGAGTTTGCT
TTCAAGAAGTGTTTCAACGCAGTTCCAGAAAGTCGCAAGA
ACAAGATGCTGCTGGCCATCATTGGGGAGGAGACAGCGTT
ACAGGAGAAAAAACGTCTGGACTCTTTCTCCAGGTTGGCG
AAGTGTAGCGGCATTGTTCTTTTCACCTTGACAGTGGGAG
ACTCCATCGCCTCTAGTCAGGTGGAGGAGCTTGCCAGCTA
TCCTTTAGAACAGCACATCATTCACCTGGGCCACTTGAAA
CATGGAGAACAGGAGTACACACAACGCTTCATGAGGACTT
TCTTCCATATACTGAGCAAGAATATGAACACCTACCCTCA
TCCATCACTCCAGAGTCAGTGCAGGAATTTTCAAGAAAGT
CCAGGCCAGCGTTTGGACTTTGAAGCTGCAGAGAGACCAG
TGTACAGGGTTCCTGTGCTCTCCACTGTATATCCAGATGT
TCAAGTAGAAGAGGACATGGAGGAAGAAGATACTGCGCCA
GAGACTGAGGACCAGCAGTCTTCAGGTCGTGGAGACTCAA
TAATCCAATCTCCTGCTGACAATACAGACAGTCTGTGTCG
CCAGAGTTCTGACCGTGGCACCGTCTGTGGTGATTATATG
CAACGCTGGTATTACAATCCAGCAGTCCGTGGTTGTTTAC
CCTTCTGGTACGGCGGCTGTGGTGGTAATGGTAACCGTTT
TAGTTCAGAGAGGGAGTGCCTTCAGACCTGTGGTAAAAAA
AATCCTGAAGTAATCCCACAGACACAAGTTGAAACGGCTT
TATTTAATGATGCCTGCCTCATGAAACAGGATGTGGGGCC
CTGCAGTAATTATGTTTTAAGCTGGTATTATGACATCCAG
CAGAATGAATGCTCTCAGTTCTGGTTTGGAGGATGTGAAG
GAAACAAAAACAGGTTTGAAACGCGGGCGGAGTGTGAGGC
CCTTTGTCTAAAGGACATTCAACCTGTATAAAACATTTTG
AACAGACTTTCTTCACCTTTTGAATTTAGCAATTATTTTC
TTGAAGCCTGAAAATTGTACTTGTGCAGGTCTGTCTACAG
CAACAAAAGAAATCCATACACAAACAGGAAATATTTATCG
TTTTGCTTTGTTCACGGCAATTATGAAGTTAAGCATTGTG
TCTAGACATTATAAGTGTGTAGAATAATCTCTGTAATACT
TTACAATAAGGTCATATTTGTTAACATTAATGTGTCAGTT
ACTGAGAAACTAACAGTAAATGTTTTATAACATTAATCTT
TATTATTGTTAGTGGATAAATCAATAGATTATTGATAATG
TGCATTAAAACAGTGATGCCCAATCTTTTATCACCGTGGA
CTGGTCAACGCTTGACAGTTTTACCTAGGCGTGGGTGGTG
GGTATATGTAGATTGCTAGGCGACCATCAACCATTTTTTC
ATAGGATGACAAGCTGACAAAACATTGCAGCACTTCTGAT
GAAAGTTTTATTTTATAGAGAAATTAAATGATTAAAAAAA
ACACACTGAAGCTGATTGGTCAGTTCTCGTCATGTGACTT
GTGGTGTGCTTGCAGCATTCTGATGATGTTCAACTGGGTT
AGGGCAAAGAACATAGAATCACCAAGAGAAAACACTCTAG
TACAATTTGGGAAACAGCCACTAGAGGGCGCGGCGGCCAT
TTTGGAATGAAAACTCTAATAGAACAACAGCATATTATAA
GTCTGTAAAATAAACTATTAAAAGTGCTGATGATTGTGGT
AGTAAGTGTTGTATTGTAATAAATAAAAAACAAAGCAGCT
GCTTGCCATCGCGATAGCAATAAGATCCAATGGAAAGCCG
ACTGCTTTCACTCCAAAATGGCGGAATCCGGGGCTGTTGC
TGGGCGCTGCTGTTGCAATTGAAAGTTCTATTGGGCATCG
CCTCTTGGTCATTCCAAGCTCTTTGGTTAGGGTTAGGTCC
AGCCGCTTGCACGTGTCGCTCAATATATGGGTGCACAAGC
CATGCACCTCCATTGGAAATATAGAATTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations