ZFIN ID: ZDB-TSCRIPT-100915-1370
Transcript Name: apoc1-201
Previous Name: apoc1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046721 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046721|OTTDARG00000033263|ZDB-GENE-030131-1074 apoc1|OTTDARP00000036806 apoc1l-002 LG_ BX004983.8 Danio rerio protein_coding KNOWN, 777 bp
GAAAATCTCCGTGAAAACAGCTGTTGTGGCAAACGGAGTT
TACTTACCTCTAAAGGATGTTTACTATAGTCATTTACCAC
ATCGCAAAGCTGTAAGGAGAACGAGAGATGAACGCGAGGA
AAGCGAGTGATTGCAGGAGGTCTTGATAGGTCAGAGGTGG
TGTTATTACACAACGTCATCTCTGTGTCCCTATAAAGGGA
CAAGCCATCTGTGGGACATCACAAACTCAGCCCAATTCTT
TCGAGGACTGCGAAGAGGGAAAAAAACGACAAGATGAAAT
TGTACTTGGCTGCAGCCGTGCTGATGCTTGTACTTGCTGT
ACACACAGAGGCCCAGGAGGAGCCCACACTGGAGCAGCAT
TTCACAAAATTTGGGACCCAGATGAAGGAGATTGCAGAGG
ACCTGGCAGATAAGACCAAAACCGCCTTCCAGAACATTGA
ACAGAGCGAGCTTGGTACCAAAACCAGGAACTGGTTTAAC
GATCAATATGAGAAGCTGAAGCAAAAGATGACTGAAACCT
TCAATTAAAAAAAATGAAAAATCAAGCCCCATTTACCTTA
CACCCCCAATTACCTTGTGTTTTGTGATATCACCTCAAAA
CTGTTGAGCCGACTGGCACATTTGTTACAGACCAATACAA
AGTCACACTGTGATGATCTGCTTGTCATTTGTGTAATGTG
TAAAATAGTTAATTTTGTGGGATGCTGTAAAATAAGAAAA
AATGAGATAAAAAATACATGCAGATTTTCCTTTTCAAAAG
AATAAACAGTGGAAAAA

apoc1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA apoc1-201 777
apoc1-202 (1) 783
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
apoc1-201 Contained in:
[BAC] DKEY-7F3 (1) (order this)
OTHER apoc1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046721 (1)
  • Ensembl_Trans:ENSDART00000132742 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH489275 (1) 809bp
    GenBank:BC128898 (1) 325bp
    CITATIONS (2)