ZFIN ID: ZDB-TSCRIPT-100915-1350
Transcript Name: si:ch211-212i14.3-001
Previous Name: ch211-212i14.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046650 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046650|OTTDARG00000033226|ZDB-GENE-100921-80 si:ch211-212i14.3|no_translation CH211-212I14.3-001 LG_ CR394546.9 Danio rerio processed_transcript PUTATIVE, 680 bp
CATTATTCCTGACGCTCCACTCAATAATGAAGACAGAGCA
GAAATGGAGGAGATCCAGAAGATCTTCAGCTCCAGAATCA
ACAAACACATCATGATCCTCATCATGCAGAACTCAGAGCA
TCAGACAGCAGAACTCAATGAAGAAACACAGGCTGTCATT
CAGAGTTTTGGAGGAAGACATCATTACTTCAGTCCTGAAA
CACAAGTGTCCACATTGATGGAGAACATTGAGCAGATGCT
GGAGGAAAACAGAGGAGGTGTTTACTCCACAGAGACATTC
CTGGAGGCGCAGATGAGTAAATTAGTGAAATATGAGAAGA
TGAAGAAGAAAATAAACTCACTGGAGACACATGTACTATC
ACAAGGTTCAAGAGTAAACACAGAGGATGAAGTGAGGATT
GTTCTTCTGGGCAAAACTGGAGTTGGGAAAAGTGCGACTG
GAAACACAATCATAGGAAGAGCCAAATTTACAGCAGAAAC
ATCTCACCAATCAGTGACTAAAGAGAGTCAGAGAGAGACA
TGTGAAATCAATGGCAGACAGGTCACTGTGATCGACACTC
CAGGAGTGTTTGATACTGAACTCACTGAAGAGGAGATCCA
GAGAGAAATCAGACACTGCATCTCCATGATTCTGCCTGGA
CCACACGTGTTCATCATCGTGCTCAGTTTAGGACAGAGAT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-212i14.3-001 Contained in:
OTHER si:ch211-212i14.3-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046650 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB767255 (1) 677bp
    CITATIONS (1)