header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1169
Transcript Name: zgc:113984-203
Previous Names: ch1073-75o15.1-001, zgc:113984-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045929 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045929|OTTDARG00000032814|ZDB-GENE-050626-82 zgc:113984|OTTDARP00000036241 CH1073-75O15.1-001 LG_ FP101857.5 Danio rerio protein_coding NOVEL, 827 bp
CAACAGTGTTGAAGGCAACAGAAACATGGTTTCTCTCTGT
GCCATTCTTGCCTTAGTGCTTTTGAGCTGCAGTCAGCGGA
TATCTGCAGAAACTGTAAATACATGCATGGATTCTGACCT
TCATCTTCGTTGTGATGCTGGAGTGATCCTTGTGAAGTCT
GTAAAGCTAGGACCACAAAAACTTAAAGGTTGTGGACCTG
CAACGCCACCAGACGAAATGTATGCTATGTGTTTTAAACT
TCCTCCAGCTGCTAAATGGTGTAATGGATTAGCGGAGTGT
GTGGTAAACAAGAAAAAACTTTTAGAGAACGATCCATGTT
TTAACCCCTACAAATACTACATCACGACCTACACTTGCAT
CCCAGCAAAAACAAGTGTGACTTGTGAAGGCAAACAGAGT
GGCTTGAAGTGTGAATATGGTAGGATTAAGATAATTGCTG
CAAACTATGGACGTACAGATGACAGAACCTGCTTGCAAAG
ACGTCCATTCAGGCGACATCTAAACACAGACTGCTATTCA
CCCAAATCGTTGGCTCTTGTGACAAAACGATGTGAAGGCA
CCCGTCTGTGTTCTGTATCCGCCTCCAATGATGTTTTCTC
TGATCCGTGTTCTGGTACACGCAAGTACCTGTGGATCTCT
TACTACTGTTCATAACGATGGCTGATCTTATGGATTTGGA
CCAATTTCCTACATCTCATCATTGGCTGTCAACCAAATAC
AGAATTCCACTAATTTCCATAACATTAGCACTGTGGTGTG
CAGTCTCTTTTCACACACTTATTGTCATGGACCTTGTGTT
CTACATTCAATAAATTCTTAAAAGAAA

zgc:113984 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:113984-201 (1)    Ensembl 812
zgc:113984-202 (1)    Ensembl 988
zgc:113984-203 827
ncRNA zgc:113984-002 (1)    Ensembl 426
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:113984-203 Contained in:
[Fosmid] CH1073-75O15 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000045929 (1),  Ensembl_Trans:ENSDART00000144851 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH551659 (1) 863 bp
CITATIONS (2)