ZFIN ID: ZDB-TSCRIPT-091203-239
Transcript Name: bloc1s6-201
Previous Names: bloc1s6-001, pldn-001, ch1073-404f17.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045264 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045264|OTTDARG00000032405|ZDB-GENE-070112-1862 bloc1s6|OTTDARP00000035768 CH1073-404F17.5-001 LG_ CU595864.9 Danio rerio protein_coding KNOWN, 870 bp
ACATGATGTTTGTGAGCCGCTCCTGGAAACATTTTCCTGA
AACATTCATCAACGGGAAATAAAAGAGCAGAGATGCAGAG
ATCCTGCAATGAGGATGATCAGTGACACACACCATCACTG
CAGTTACTGAGGATCCGGTGTGTCTGTGTGTCATCTGATG
AAGATGATGATGGACAGACAGGAGGAGGAACAGCAGGACA
CAGAGTGTAGTGTGACCGAAGACATTGTGTGTGTGGATGA
ACAGACTGTCCAGCGACTGACAGATGGATTCTTGTCTCAC
TACCTGCCAGAGCTGGACACATCTAAACAGGCCCTGCAGG
AGCTCACACAAAATCAAGTGATCTTGCTTGATACTCTGGA
GCAGGAAGTCACGAAATTCCGCGACTGCAACGCCATGATT
GATCTGAACGCGCTGTTCACAGAGGCCAAAGTTTATCACA
GCAAACTGGTGAATATTCGCAAGGAAATGATCGTTCTGCA
CGACAAGACCAGCAGACTGAAGAAGCGAGCGCTGAAGCTG
CAGCAGCACAAACAGAAGGAGGAGCTGGAGAGAGAACAGC
AGAGAGAGAGAGAGATGGAGAGGGAGAGACGGCTGACCGC
TAAACCGGCCAAACGCACCGACAACTGAACACACACACAC
ACACACACACACACAGAAATGGAGAGAGAGAGATTGCTAA
ACACACACGCAGACATACAGAACTAGAGAGAGATCACCAA
ATGCAAACGTCTGAACACACATCCACACCCATATGCAGGT
GATTTTATCAGGATTAAACACACAGCTGCATCTCATATTT
GGCTCTTATCATAAATCATCATCTGTGCGTTCTTCTCCAA
ATAAATAAATCTGATAATAATAATAATAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bloc1s6-201 Contained in:
[Fosmid] CH1073-404F17 (1) (order this)
OTHER bloc1s6-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045264 (1)
  • Ensembl_Trans:ENSDART00000142945 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC129406 (1) 913bp
    GenBank:BC164576 (1) 499bp
    CITATIONS (2)