ZFIN ID: ZDB-TSCRIPT-091203-16
Transcript Name: gdpd4a-001
Previous Name: ch211-135h6.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045281 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045281|OTTDARG00000032418|ZDB-GENE-091204-436 gdpd4a|OTTDARP00000035784 CH211-135H6.2-001 LG_ CU459145.21 Danio rerio protein_coding NOVEL, 1781 bp
CACAGAAACACCGCGACAGTCCTCACATCCACTCGGAGCC
GCTCTGGTTTAGCGATTTTATCAATAATAACCGGAATAAC
GGCTGACATATCGGTCTGGTGCTCCAGATCTCCTGGTTCT
CCTCCATCCGTCTGCTCCGGGCTGCCCCATGCAGGGAGCG
GCTGATCGGTGAGCCTGTCCAGACTGAAGCTGGGGAAGCT
AAAGGTGGTGCGGCGGCAGCTGCTGCAGCGCTATGAGCAC
CAGCCATTTGTCTCCTGTCTGGCCGGTCTGTACGGCTGCC
AGTGGAGAAGATACCAGCGCGCCAAAGCCCAGCCGGGAGA
GTGCTGCTGCAGCCGGTTGGAGTGCAGTAGTTTCGCTCTC
CTCATCGTAACGTTTTTCCTGACGCTGATATTCCTGTATT
TCTGGAGTGAAGCGCAAAATGATTACAACGACTTCGACTG
GTTTAACTTCGGGAACCTGGGCTTCTGGTTTCCGTGGTCA
GTGGTGTTGCTGGTGGTCTCAGCGGGTCTCTTCACATACA
TCGCCCTCCTCCTGGTCCTCGCCGTGTGCCTTCTCTCTGA
AGGACAGAGGCTTTACCTTCACTGGAGCCACAAGATTGGT
ATCCTGGTGACCCTCACCTTCTCCATCAGTGCCACCGCTG
TGCTCTCTGACTTATGGAGTAAAGAATGGACGACGCTGCT
CCTTTCTTTTCAGGTCACGGCGCCCTTCCTGCACTTGGGC
GGAGTTTGTATAATGACGCTGCTGTCCTGGCCAATCGCCT
TACACTTTTTCCGCATGAATAAGAGAGTGAGGCAGGTGCT
GATCCTGAGCCTGTATTTGGCGGTTCTCTTCGCTCTCTAT
CTGGTGCCGCTGGGCATGTATTCGCCTTGTATCAAAGAGG
AGGGCACGCTGGGGCCGGCGCCAACCCTTATCGGGCACAG
AGGAGCGCCCATGCTTGCACCAGAAAACACTCAGATGTCC
TTTGAGAAAGCAGTTGAAGCTGGAGGAGAAGGACTGGAGA
CGGACGTGGCCATCAGTTATGATGGCGTCCCGTTCCTGAT
GCACGACAGCACTTTGAGGAGGACGACCAACGTGCATGAA
GTCTTTCCCAACCGGACGGACTCTCCGGCGGCCATGTTCA
CATGGGCAGAGCTGGAGATGCTCAGCGCTGGATCCTGGTT
TCTGCGGAGGGATCCTTTCAGAACGGCCTCGTCTCTGAAT
GTAAATGAGAAGATCGAGGTCCAGAATCAAACAGTGCCGA
CCCTAAAGGAGTTCCTCAATCTGGCTGCTCAGCACCAGAG
TCTGGTGATCTTTGACCTCAGACGTCCGCCTCGAGGTCAC
CCGTACCGGGACACGTGGATCACTCGCACCCTGGAGGTCA
TACACAACGAATCCTTCATCAACTCCAGCCAGGTGTTGTG
GCTGCCGGATGATCAGAGGAGTGTGGTGCAGGAGCTGGAC
CCGGAGCTGCAGCAGACGTCTGGAGATCACGCCTCAATAG
AGGAGCTGCAGGAGGAGCACATCGTCAGACTTAACCTGCA
TTACAGCTACATGTCCCAGGAGCAGATACGAAAGTACGCG
TCAGTGAACATCAGCACTAACCTGTATGTGATCAGTCAGC
CGTGGTTATATTCATTAGCGTGGTGTGCTGGCGTTCATTC
GGTCACCACAAACGCCCTGCACGTCCTGAAGAAACTGCAG
CGGCCCGTGTTTCTCATGACTCCAGATCAGTACAATCTGA
TGTGGATCCTCACCATTATCGTCTCTGCTTTCTTCATCAC
CGCTGTTTTCATTTTCCACTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gdpd4a-001 Contained in:
OTHER gdpd4a-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045281 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DV597309 (1) 843bp
    GenBank:AL919321 (1) 457bp
    CITATIONS (1)