header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091203-128
Transcript Name: pak1-001
Previous Name: ottdart00000045279

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045279 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045279|OTTDARG00000032413|ZDB-GENE-030826-29 pak1|OTTDARP00000035782 pak1-001 LG_ CU459145.21 Danio rerio protein_coding KNOWN, 1690 bp
GTGGCCATCAAACAGATGAACCTGCAGCAGCAGCCCAAGA
AAGAGCTGATCATCAACGAGATCCTGGTCATGAGGGAAAA
CAAGAACCCAAACATCGTCAACTACCTGGACAGTTATCTG
GTTGGCGATGAGCTGTGGGTGGTGATGGAGTATCTGGCTG
GAGGCTCGCTGACGGATGTGGTGACAGAAACCTGTATGGA
TGAAGCACAGATCGCAGCCGTCTGTCGGGAGTGTCTGCAG
GCTCTGGAGTTCCTGCACTGCAATCAGGTGATTCACAGAG
ACATCAAGAGCGACAACATCCTGCTGGGGATGGACGGCTC
CGTCAAACTCACTGATTTCGGCTTCTGCGCTCAGATCACT
CCCGAGCAGAGCAAGCGCAGCACAATGGTCGGGACGCCCT
ACTGGATGGCGCCGGAGGTGGTGACCCGCAAGGCTTACGG
GCCCAAAGTGGACATCTGGTCTCTGGGCATCATGGCCATC
GAGATGATCGAGGGCGAACCGCCCTACCTCAACGAGAACC
CACTCCGGGCTCTGTATCTGATCGCCACTAATGGGACGCC
GGAGCTGCAGAACCCAGAGAAGCTTTCTGCTGTATTTCGG
GATTTTCTAAACCGCTGTTTGGAGATGGACGTGGAGAAAA
GAGGCTCTGCCAAAGAGCTCCTACAGCACCAGTTCCTGAA
GGTGGCCAAGCCTCTGTCCAGCCTCACGCCCCTGATCATA
GCGGCCAAAGAGGCAGCAAAAAACAACCGCTAGACCCTGC
GGGACGCTACAGCCCGGCCCCACCCGTCCTCCACCCCGAC
CCCGGAGCGTCCCGTCAGCCGTCTGTCTCTCCGCTGCTCT
CCAATGAGGCTCTGAATGATCACACCACTGGAAACAAAGG
GCCACAGCGCGTCAGGCCCAATGCATTATGGGGGAAATCG
CCCTGTTTCTCACTGGCTGACTCTCTCTCTCTCTCTTTAT
CTCTCTCTGGGTCTCGCTGTCAGTTCTTCTGTTTGCTTTT
TTTTGTGTTTAATGCCTGTCATGGAAACACGTGTTTTCAT
GTGCGTCAAATTTTTTGGTTCATTTTATGACGTTTTTTAA
CTTTATGTGTGTGTGTGTGCGCGTGTGTCAGAGAGAGAAT
GTGTGTGTGTGTGTTAGATTAGATGAGATGGCGACATATG
CGTGGCACGTTTGTACGCCGATCTCGATGACGGAGAAATC
TCTACACGTTTTTTTTGATATGGAAACATGATAATCTGTA
ACAGACTATTGATTAAGGTACTATGAAGGATGCCTGTGCA
TGAAGAGACTGCATTTCATATGAAGAAACGACCGCCTGAG
GTCCGTTCTGTCCCATAATCCCTCTCCAACATGGCGGAAA
TTCAACAAAACATCACTGTGCTTTGATGTTTTGCTTCGAC
ACAAATGTAAATGAAATTCAGATGCGTTCCTGTACCCTTC
GGCCTTAAACTGTGACATGAATGGTACGATATTATTATTA
TTATTATATGGTACAACGGCACAAACCAAGACGACTCAAT
CTGACGCCATTTTGATTGGTTGGTTGAATGGACGGACGGG
GTTTGTTTAGAGAAAATCTTTCCTGTAAGCAATCAGAGTC
TCTGCGAGCCATAAACTGTTTATAAGGCCTTTTGATGAAT
CCGAATTCTTAAAGTAAATGGGACGAATAAACTTCAGAAT
TAAGCAAAGA

pak1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA pak1-001 1690
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pak1-001 Contained in:

OTHER pak1-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045279 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC044138 (1) 2811bp
    GenBank:BC065603 (1) 2802bp
    GenBank:BC165171 (1) 1801bp
    CITATIONS (1)