header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-346
Transcript Name: man1b1a-201
Previous Names: ch211-181b18.1-001, ch211-231o6.2-001, man1b1a-001, ottdart00000043825

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043825 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043825|OTTDARG00000031487|ZDB-GENE-091116-34 man1b1a|OTTDARP00000034737 CH211-181B18.1-001 LG_none CR376852.17,CR392357.6 Danio rerio protein_coding NOVEL, 2795 bp
AAGCCAGTGACGCGCGCGCTAGAGGATCACGTGACGCAGT
AAGGAGCTGTCACATATAAACATTGCACTGAACACACACA
TCTGTTTGACTAATGACAACGAGGATGTTTAATTATGTAG
TGATTAACACATTACGGATATACTGTAGATCAGCATGAAT
GAGCGGTTATGGGAGAAACGCGCGGTTTGTGGAGAGCAGC
GTGATGGAGGAGAGATAGAGATCTGATAGCCACTCCTGCT
GTCACCTACTCAGTGTATACTAATACTACACTCACTCTGG
ATGGATGTGTTGGCCGTGTGACCTCCATATAGAACCTCCT
CCTGACCAGGAGAAGCAACTTGTCCCATGAAAGAGTCTTT
GAGTGGTGGTCTGGTAGAGATGTATTCACCACAGAAGAAG
GATTTTGTGTCTTTGACGGTTCGAGAACAACACAACCGTG
GCTACACCAACGGCAAACACCGGAGACAGTCCTGCTGGAG
GAAATGGAAGCAGCTTTCTCGACTGCAGCGCAGCCTCATT
CTCTTCCTGCTGGCCTTCCTCTTTATATGTGGGATTCTGT
CCTATTCCAGTCTCACGGAGCAGTGGAGAGGTATCTCTGA
TCGGTCATTGAAGGAGGATTGGGATGAAGTGGATAATCGG
GGTCTCAGGCCCATTCCTCCTGGCCTCATCCCAAAGCTGT
CTGCAGGAGTTGGTGTTCAAGACGTCCAACCAGATGTTAT
GCCAGAGCTTCAGAAACCCAGCATTCCATTACTTCCTAAA
CCTCCAGCTATGAGAAAACCTCCTAGCAAGCGTGGTCCCC
CAGCGCTACAGAAGCGAATGAACGTGTCCGACTGGCAGCT
GAAAGATGGAGAAGAAGGCTTGATCAAGACAGATGAAGAC
GGAGCAAAAGAAGCAAAAACAGTCATTAGCTGGCGCGGGG
CGATGATTGAGGCAGAGCAGGGCACTGAGCTTCAGTCCAC
CATTCAGGGAAAGGATGCAACTGTGGTTGATGCTGAGGAA
GCTGCTGACTTAAAAACAGGGACATTGAAGCCAGTGGATC
GTGTGGAAGCGGTGCAGGAGGCCTTCAGGCATGCATGGAA
AGGTTATAAGGCTTTTGCATGGGGTCATGATGAGCTGAAG
CCACTATCTAAGACTCATGGAGAGTGGTTTGGTCTGGGCC
TCACGCTCATAGATGCACTGGACACCATGTGGATCCTTGG
TCTGAAAGACGAGTTTGCAGAGGCCAGGAAGTGGGTGGAG
ACAGAATTATCCTTCTCCAAGAATGTGGACGTCAATCTTT
TTGAGAGCACCATTCGCATTTTAGGAGGTCTCTTGAGCAC
ATATCACCTGAGTGGCGACACTCTCTTCCTGGATAAAGCT
AAAGACATTGGTTTCAGATTAATGCCTGCCTTCAAAACTC
CATCTAAAATCCCCTACTCTGACGTAAACATTGGTAAGGG
AACGGCTCATCCTCCACGCTGGACCACAGACAGCACAGTT
GCAGAGGTGACCAGCATTCAGCTGGAGTTCAGAGAGCTCA
GCCGGCTCACACAGGACCCGCAGTATCAGAATGCAGTGGA
AGAGGTGACCAAACAGGTCCACAGATTGGAGGGGAAGCGT
GATGGACTGGTGCCAATGTTCATCAACACAAACAGTGGCA
AATTCACGCGGCGAGGGGCCTTTACCCTGGGGGCCCGAGC
AGACAGTTACTACGAGTACCTGCTCAAACAGTGGCTTCAG
GGCGGCAAGAAGGAGACTGAGCTGCTGGAGGACTATATTC
AGGCAATAGAAGGTGTCAAGAAGAATCTTTTGAAACAGAC
TTCTACTAGTAAACTGACCTTTGTTGGAGAGCTTTCCAAT
GGCCGTCTTAATCCCAAAATGGATCATTTGGTTTGTTTTC
TTCCTGGAACACTGGCTCTCGGTGCCCACAACGGTCTGCC
TGCAGATCACATGGAGCTGGCCATTCAGCTGATCGAGACG
TGCCATCAGATGTATGTGCAGATGGAAACAGGTCTGAGTC
CAGAGATTGCTCACTTTAACCTGCAGAACCACAACGGACG
AGACATCGACGTGAAGCCTGCAGACAGACACAACTTGCTG
AGACCCGAGACTGTTGAGAGTCTGTTCTACATGTACAGAT
TCACCAAGGACAGCAAATATAGGGACTGGGGCTGGGAGAT
ACTGCAGAGCTTCAACAAGCACACCAGAGTTCCCAGTGGT
GGCTACACTTCTATAGGTAACGTCCGGGACCCGTTAAACC
CTGCACCCAGAGACAAGATGGAGAGCTTCTTCCTGAGCGA
GACGCTAAAGTATCTCTTCCTCCTGTTTTCTGATGACACC
GAGCTCATCAGTCTGGATAAATACGTGTTCAACACTGAAG
CCCATCCGCTGCCCATTTGGCCCTCAGCCTCATGAGGAAC
CAATGCCGGCGCTCACTCTCAATTTCAGTGATATTGACTT
TGACCAGCGATGATGCAAGCTTCACCATAAGCCACCCATC
AGGACCTGCGCTTATGCACTTGAGCTTTATTTGGTGCAAC
AAGACTTTATATTCACCCTGAAGGACCCAGAGGTTTGGTG
ATGAAACATGTCAAATTTATTTTCTAAATTCTGTACTTTA
CAACTTGTGACACTCTTGCATGTCGGAATAACTGCCATAT
CCGTCCATATTTGGGACAGGAAAATTAGTGTCAGAGCTTC
GTAAATCACAAGGCAGACTGCTGAAGTCCCACACTGTGAA
AATGCCAAGCACTTTGTCAAATGAAACTTGTTGTTTTGTT
GGTTGCGTATACATAAATGGATGCTCTCGATGTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
man1b1a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000043825 (1),  Ensembl_Trans:ENSDART00000114715 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EG581143 (1) 917 bp
GenBank:EH457751 (1) 873 bp
GenBank:CO959929 (1) 777 bp
GenBank:BM103988 (1) 699 bp
CITATIONS (2)