ZFIN ID: ZDB-TSCRIPT-091110-2131
Transcript Name: arfgap2-002
Previous Names: ch211-71n6.1-002, ch211-71n6.3-002, ottdart00000045345

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045345 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045345|OTTDARG00000032456|ZDB-GENE-051120-177 arfgap2|no_translation CH211-71N6.3-002 LG_ CU469519.11 Danio rerio protein_coding KNOWN, 384 bp
ACACACAGATGGTCAGGTTACCTAGAGAGTGGCATTCAGG
ACATTGATCCACCTTTTCTCTCTCCTTTCTTACGCCAGCT
GTGGATTGACAGCTCCAGCTGTGCTCAACCATCACCTGTT
GAGAAGAGAGAGACTGACTTCTTTGACGAGCACACACAGC
CTGCCATCAGTTGGGACATGGCGTCCCCTTCACTAACAGA
TCAGAATGGAGCTGAAAATGTTAATCCTCAGCTAGCACAG
AGCAATCCTAAGAATTCAGAAACTCCCAACACCCAGCCTG
AAGAGGGTCCAAGCATTGAAGGACTGAGCACAAGTCCTAA
AGCCACGATAGACGTCAAACCTTCCATCATTGGAAAGAAG
AAGCCAGTAGCTGCAAAGAAAGGG

arfgap2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA arfgap2-001 (1) 2020
ncRNA arfgap2-002 384
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arfgap2-002 Contained in:
OTHER arfgap2-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045345 (1)
  • Ensembl_Trans:ENSDART00000142260 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB772688 (1) 402bp
    CITATIONS (2)