ZFIN ID: ZDB-TSCRIPT-091110-196
Transcript Name: si:ch211-266i6.3-201
Previous Names: ch211-147g3.3-004, ch211-266i6.3-001, ottdart00000043272, si:ch211-266i6.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043272 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043272|OTTDARG00000031119|ZDB-GENE-030131-5420 si:ch211-266i6.3|OTTDARP00000034302 CH211-266I6.3-001 LG_ AL953904.10 Danio rerio protein_coding PUTATIVE, 2448 bp
GTCATCACCAATCGCAGAGCTCGCCGCGCCGAACTCAAAT
CTGTTGAAAAAGCGCGTGTTGTGCTTCAATCTCCTTCAAA
TATTTTTCAAGTTCAGGTTTGGCCTGAGTTTGAGGTTCGT
GTCTTTCCTCGTTGACAGAAGAAGGCAGAGATAACGGGAA
AGATTGTCATCTTTGAAGAACTGTCCTTACACTGGTAGAT
GAACATAATGGAGTCTGTGGTGAGAAAGAGAAACAAGGAG
AACACTAAACCAGTTTCTGGCCTTAAAAAACAAGTCATCA
GCAGTACTGCATCAAAACAAAGAGTCCTATGTAAAACGGC
ACCCCTTCAGTCAAAGAATGATTTAAAGGAGGATAACTCT
GGAAAGAAGGGAAAGGATGTTAGAGCTCAGAACAAAAGTA
ATGATGCTGATCCTGCTAAGCGTTACACTCTAAGCCAGGC
CTTTCGTACACAGCAGACTATAAGGCAACGAAAGCTTGTG
GAAGAAGTTCAGAAACCACCTTCTACGGTCTCTGCTGTCC
AGAAATCCAAACCTGGCACATATAAGGGCCGTGTGATACA
GTCAAAAATCGATTGTTTCAGAAAACCCAGTGGGGACGTG
AAGACCACAGAAAAGAAAGTGATTTCAAAACCGGATGAGA
CCAAAGCAAAACCTGAGGTGTCCAAAATTCGGTCAAAGTC
TGTTACTTCTCTGCAAACCTCTATTAAACCTAGAGTCAAC
TCCGCTCTGTCATCCAGATCAAAATCGGTCTCTGATGTCC
CTCGGAATGTCACTGAAAAACCAGTTCATAAGTCTGTTTC
TCTTAAGCAAATACCTCAAAAGGTGCCAAGCTCCATCTCC
CAAACAGGAGCCCACCGAGCTTGTGTTCTTCCTAGGCCAG
CCCCTTTAGCTACAGGGCGCTCAGCCACCAACAAAGCCTT
CACTATGAAGAAGAAGGTACCTGTGCAGGTGCCAAAACCC
AAGCCCCCTCTCACTGATCAAAACGTCAGCAGGCCTGTCA
CAAGTACAGTCAGCCAGTACAAAGTACAAATGGAAACGGC
TGAAGAAAGAAGAGCAAAGCTTGCAGAGTGGCTGGCTTCT
AAAGGAAAGTCTCTAAAGAGACCTCCGATCTCAGACAACT
CAGCTGTGCTTTCACGGAAACCAGCTCCACAGCCTAAACC
TGGACCCAAAGCTACTACCTGTGCCCAATCGAAGCCTGTC
ATGCAGAAGACAGAGCCTGTAAAACCAGCCCCTGCATTGA
AGACCAGCAACCAAACTGATAAAGTCCCTGGCACAAAACC
AGTGAATACAAGTGAATCAAGCAATATTATGAATACTACA
TTAGACTTGCTGGACAATAGTGACATGGATCTGCCAGTTG
ACCCAGAGATAAGAATGGAGTCGCTGGTGATGAACTTGTG
TGATAAACTGGAGGCGATGGAAACACCCTCATCTTGTGAG
GATGCTATGAATGCTGACGAATGTGATGCACCGGCAGATA
AAAGAATGGAAATGCAAGTAGAGGAGCACACAACAGATAG
AGTGTTTGAAATTCTAGAAGAGGAAGAACTTGGGGATGAG
GAAGACATTACTGATGACATTAAAAAGGCTGACATAAAGA
ATGAGGATGATCTGGAACCTCAGGAGAAGAAACTATTTGA
TAGTGAAGATGATGATGGCGAGGAGATGAGGTGTACCACT
CCAGAGACGGAAGGAGCATCCATTGTGAAATACAATGTAA
AAACTACTCCTTATCTGCAAAGTGTAAAAAAGAGAATCGA
ATGCGAGGAGGCACCAGGCAGTGGCTCTCGACGCAAAAGC
ACCATTAAAGACCTCAAGTTTCTGACACCGGTTCGACGAT
CAACAAGAATCCAACGCAAGTCCTCTCGTCTGCCAGGTAT
GCTGAACGATCACGACACTTGCGTCTCCTCGTTGGCTGAG
CTGGTACAGATGGAAGATGCCGATGCGAATGCTTACATCT
ACAGAAAAAACCCAGCACTACTGGAAGACTTGCCTAATCA
CCCTGGAGACTTGGCAAAAGTATGCAGTTAAACAAAATGA
GTCTCTTTGAAATTGCACATTTATAGCTTATGTAATGGCT
GCATTTTAAGGTATTCTTTGTGACACTAAAAAATAATTTA
ATATTTAACTGTTTGCATTGTGCTGCTACTACATAGAGTA
ATATCTTAATGTCTGCTTGACAATATGACTTTAGGCACTT
CTGTCAGCATCTTCTGTGCTTGCATAAGGCTTATGTTTGT
GTGTGTGTGTATATATATGAAAAGCTATTTCTGTGCCTTG
TACCACTTTATTATAACTGCTTTGTTCATTTTATAAATGT
GGAAGATGAAAAAATTGTAAAAAGTAAGATTTGTTTTGGC
AAGTATCGAATTTAACAAACCAAAAAAAATTTCCCTTTTC
TTAACTTGCATTTGTTTTTCTCCAAGATACTTCCAGTACT
GCAAATGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-266i6.3-201 Contained in:
OTHER si:ch211-266i6.3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043272 (1)
  • Ensembl_Trans:ENSDART00000137373 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH500344 (1) 1017bp
    GenBank:CT617687 (1) 811bp
    GenBank:CT598031 (1) 791bp
    GenBank:CT673367 (1) 781bp
    GenBank:CT601942 (1) 767bp
    GenBank:EB934450 (1) 557bp
    CITATIONS (2)