header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1673
Transcript Name: pknox2-002
Previous Names: dkey-84o3.4-001, ottdart00000043344

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043344 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043344|OTTDARG00000022230|ZDB-GENE-031118-112 pknox2|no_translation CH211-123N8.1-002 LG_none CR925737.8,CU062503.6,BX950197.23,BX897743.8 Danio rerio protein_coding KNOWN, 680 bp
GGTCTCCATGTGAAGCTATCCCATGATGCAACATGTGTCC
CCAGCACCAGCATTGACCATGATGGCCACACAGAGCGTCC
CTCCACCATCATACCAGGAGAGCCAACAGATGACAGGCAC
TACTCAGCAAAACTCAAAGGGCCAGCATGTGCACCTCTCT
GCAGCGTCAGCAGGAGGAGCCGCTCCGGTCAGCGTGACTC
TTGACCCTCAAGCCCAACTGGAGTCTGACAAACGAGCCGT
TTACAGGCCATGCTGGGCGGAACCGACGACTCCATGGACG
GCACAGAGGAGGAGGACGAGGAGGAGGAGGAAGACGAGGG
ACTCGATGAGGACGACGACGAAGAGGACGACGAAGAACAC
GAGGCGAGCAGACAGATGATCAGGCGAGATCTGGGCCTCA
ATCACAATGAAGGACTCGAATAAAGAATGAAAAATAGCAT
AACTGACTTAACTCTTACTCATCACCATGCAAAACATCTC
AACGCCGCACAAATGGCTCTCATTGGACACTAAGTGCCAT
GGAGCACCCAATCATAATGAAGGGGAGGGGCCTACCATTC
TGGACTCCAAAATTGATGGAACATTGTATATTGGGCCGCT
TTACGCAACCGGTCATGCTACTCTCATGCATATAATCCAT
TTAAGCCTTACTTTCTTTAAATATGTCTCTTTGGTTCTCA

pknox2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA pknox2-002 680
mRNA pknox2-201 (1) 2611
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pknox2-002 Contained in:

OTHER pknox2-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043344 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BG985832 (1) 773 bp
    CITATIONS (1)