header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1631
Transcript Name: ehbp1l1b-201
Previous Names: ch211-222e20.7-001, ehbp1l1b-001, ehbp1l1b-002, ottdart00000043201, si:dkey-48m5.3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043201 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043201|OTTDARG00000031071|ZDB-GENE-091204-238 ehbp1l1b|OTTDARP00000034252 DKEY-48M5.3-001 LG_none CR545465.14,CR450793.12 Danio rerio protein_coding NOVEL, 9265 bp
TTTGCATAACCCTTCCTACCTACTCCTGCACTTCTTCCTC
CACTTTCATCACTTCATTGTCAGACAGCTGCTTTTAAAAA
CACTTCATCTCTTGACGCTCCATGACGCGAAAGATGAAGT
CCTTCCTCTCTATTTCTTACGCACAGATGTTGCTTTTTGC
ACCAAGTCAACTAATTGTCATACACTGACAGTCTGCTCTG
GTGTGTGTAACGTGATGCAGTAGTTTCCGTAAATGGTCTT
TACTCGATGGCGACAGTTCGGTGGGACTGAGCCGCATGAG
CTGCTGCTTGTGCTCCTCAGCAAGGACATTTCACTTCGCG
AGCCACTTGACAGCCATATATTCGAGTAGTTTTTGTACTT
TTTGTGCAGTGGCGGGACGGTAGAAAGCTTATTTCCATGC
GCCTGACTTCATTCGCGGATACTGCATTTCCTACAGAAGA
ATGACTTCGGTGTGGAAAAGGTTACAAAGAGTTGGCAAAA
AAGCCACCAAATTTCAGTTCGTGGCTTCGTATCAAGAACT
TGTCCTGGAATGTACAAAGAAATGGCAACCAGACAAACTG
AGAGTGGTGTGGACCAGGAGGAACAGACGCATTTGCTCCA
AGCTTCATTCATGGCAGCCAGGCATCAAAAATCCTTACAG
GGGAATGGTGGTTTGGCCCGTTCCCGAGAATGTGGACATT
ACAGTCACACTCTACAGGGATCCACATGCAGATGAGTTTG
AAGACAAAGAGTGGACATTTTTTATTGAGAATGAGACGGC
AAAGGGCAGTCGGAAAGTGTTGGCATCTGTGGACTTGAAC
ATGAAGAAGTTTGCCAGTGCCACACACTCGCAGACAGACC
TGATGCTCAAAATGAAGCCTCTGTCAGTGAAAGTGGTGGA
GGCCACACTGAAGCTGTCTTTATCATGTGTGTTCCTCAAG
GAGGGGAAAGCTACGGATGAGGACATGCAGAGTCTCGCCA
GTCTGATGAGTGTAAAGCCAACAGACATTGGGAACCTGGA
CGACTTTAATGAGAGCGATGAAGAAGAGGATAAGAGATCC
AGCACTGGTATCAATCTCAGCACTGCAGCTCCAGCACCTC
ACCTTTCTCTTCGATCAACACGCTTCCAAGAAAAGAGACC
TGCGTCTTTTAAGAGCCCTTCAGCAGCAGTCAGTGGTAAA
GAGAGGCCTTCTGCTGGCCTCCTCTCCCGACCAGCGTCTA
CCACTGTCCATAAACCTGACCTACCATCACGTCCACCTTT
ACCCACTCCACCTAGTCCAACCCCTCGCACCATGCCCTCA
CCCGCCCGCACCAGACCTCCACGTCCACCACCTATTGCCC
TGCCACAGGCTCTACCTGACCCCCACACAGAGCAAAACAC
TGCCGGTTCACTCCCTCCAGCATTGCCTAAAATCTTCCAG
CCCTCCCCTGGCTCAGCTCCAGTGTCTTTCCCAAGAAGGC
TGTCGGGCTCTGAGGGGCCTCCAGAGGGCCCAGTGACCTC
TGATTATCCTCTGCTCAAACTCCCTCGGGCTTCTCTGTCT
TCTCCATCGGATCCTTTCCTCCCTCAGCCTCCCTCTCCTC
CTGATGTACTTGTGAAAGATTCTTTTGGAGCACCTCGTGC
CAATGTTTTTAAGCCCAAGATTGTGCCCGGTGCTCGCCCT
GTTTCCCCCACGCCAGTCCCCTTCCTCGAGCCCAAAACCT
CCTCGCTCTCGCTCTCCGACACGCTTAAGCATCCATCTGC
TGGCACTGTGCCAGATCTAAATGAACAGATGACGGCAGTG
TCTGCATCTCCTTTTTTCACTGTCTCTCTAAATGAATCTG
TGACCCCTGTTCCTCTGCTAAGCAAACCAGACCTTGAAGC
CTTGTGCGAAACCCGTTATTCTTCTGGTCAATTTCCCAAG
CCACCTTCACCTTCCTCCCTCTCCTTCCCACTGCCAGTCA
CTTTTACCCCAGCAGTTTCTTCCTCTTCTCTTCCTATCTT
GTCCACTGATGCCCTCGCATCTGCCCCCTGCTGTTCACCA
CTATCTTCTTCGGCTCAGTCAGATTTACCCAGAGAGCTCA
ACACACTTACAGAGGAGGATCAAACAAATCCATTTCTACA
AGATATTCTTGCAGAAGAAGCGAAGAACTCTGAACCTAAA
AACGAGCAGCATCACTCATCTCGGACCGTCAGCAGCATTA
GCATTGCCAATCAACAAGTATCTTCTTCGCTCTCTCAACC
TGAAACCAACAGCACAGAAAGAAAAGAGCTCAGACCTGCC
ATGGCTGTAAAAAGTCTTGGTCTTGAATCATCATCAGGAG
GACAGCCTGTGGAAACTTTCGGATCTGAGGAACTGGACAT
TAGGACTCTTCCTTCTCCTCATCCATTCTCAAGTCCAGCA
ACAAAACCTCTTTCATCTGCAGTTTTCACTCAAATGGAGA
AAAAACAGCCAGTTTTTATTGCAGAGAAACCACCATTGGC
TGAGGAAGAGCCGGATTTTAAAGTAGCTGATTATGATAAA
GTGATCATGACCTCTCAGCCTCTCATCAAAGACGTTACAT
TTGAGAAACAGCCTGAGAAAGAGCCCCTCAGAACTGACAG
TGAAAAACAAATGCAGTCCAGTCAGGTTCAAACTTTTTCA
ATAACCACTGATGACTTACTGAAGAAAACAGAAAGCACAA
AAAATGACTCAGCAGAGGAAGTTGTTTTGAAAGAGGAACC
GAATGAACTGAAGGGTACTTTACTTTGTGCCGACCTCAAC
AAGTCAGACGAGGACAAAATCATCAAGAAATTTGCCTCCG
CTTTGGTTACCAATTTAGAGCAAAATGCTCCCAACGTATT
ATCTAGTTCATCACAAGATGATCATAAGGAAAAGACTCAA
GTGTTGATGGAAGAAGTCCTTACATCTAATACCAGTGGGA
ATTTGAGAGAAAAACAATCCCATAAGGATGATCTGGACAA
CAATTTAATAATTGAGGAAAGTCAAAATGAAATGGCCTTC
ACTAGACCTGAAAGTCCTAGCATTAGTCTCCATCCGGCTG
CCCATATTAAATCAGATCAGCCTAAAGAGCTTCCTCTCAT
TCATTCCCAATCCCTGGACCTCCAAATTCTTAAATGCATC
CCAGAACAAAGTCCAGCAGTCAGTGAACCTGCCAAACCAG
AGCTGATTGTGAAGGAGTCAGACAACACAGTGTTGGAGGT
CCCGTCAAATGCCCAAGCAGAAGTACCAATCTGGAGTTGT
CTGGAAGAGAAAGTACAAGAACAAGAGAATACATTGAGAG
ATGAGGAGATACATGAGCACAAAACACCTCAGAAAATGCC
AAAGTTAGAAACTAAATCCTCAAAAAAGTCTGTAGAATCA
GGAGATGAAAAAGCAGTTTCTGAGGATGCTGAGAATTGTA
TTTTAAGTGAACCAGTGTCCCAGCAGCCACTACCCTCCAT
TGTCCTTAAACCACAGCCATCTGAGTCTGTTAAGGAAAAG
AAAATAGAAGCTGTTAAAGTCAGTATACCGGTCCGTATGA
AGCCTGCGCTTCCTGTGATCTCCCCTGCTGCTTCTGTAAA
GGGAAAGGACAACAGGACATCGCTACATCTGGAGGAACTT
TGCCCTATGACGCCCAACCAGTCTCTGGATACAGAGTCCT
ACGGAAATAGTTTAAGGAAAAAGGTCACGTTTGAAGCAGA
AAGTGTGTTGTGGGCCACAGTAGAGGAGAAAACAAAAGAA
AACAGTGATGAGGGTGTAAGCTTGGGCGAGTTGAAACTGG
AGAAGGAGGTTCTGGATAAGGGCCAACTTGGTCAGAAAAA
ATCAGAAATCAAGTCTAAGGAGCAAGATGATTCCTTCATT
TCCACTCATAAAAACACTAACCAAGAATGCCAGGAAATAG
AAAAGACAATAGACAAGGATGATTCAGATGATAAGCAGAT
GGTGAAAACCGACAGTGAGACTATTTGCACAACTCAAGAT
GAACTTGAAGATGACCTGAAGTCTGTAGATGTGTGTTCAG
AGACCCAACTCAGCCATGACCTGGATGTGAAAACTGACAA
GTACCTGGACTCAAGCAAACAGGAGCATGACTCTGATCAA
GAGGATGTATCTGTAGGCTTCATACGGGGGATTTTTGGTG
TCCTTTATAAAGGTTATGAGACTGTGACGTCTATACTACA
GCAGCCAAGCGAAGCAGAAACAGATGTTCAAGATGACCCA
ATCTTGGACAACCAAGATGGACCCGTGGTTGAAATTCTTC
CTCCCGAGGCCTTCTGCGACACCAAAATTAAGCATGCAAC
TGTCGATGAGCCTCAGGAATACCTGTTCAAGGATTTGTTG
CCATCTGGCGAGTTACAGATAGATATACAGACCTCTGAGC
CTGTGGCCATGAGCCTGGTGGAGTGCCTAAAACTGGCTGC
CAGAGAAACTCAAACCAGATCCGTTAATGATAAAGAAAGC
CCTTCAGAACAGAAAACAACAAATGTGAAGTCTCAAATAA
TGACGCCTAAACAAAGCATGACAGTAGATTTGAAACCTGA
AATTGTGGTGTCAAATGAAGAAAAGAAACCTCTGGAAACC
ACACAAGAAGACATAACTGTTAAGGAAGAAGTGCAAAACA
TCAGCATTGTGGAAACAGATGGTTTGGTGGCCAACGTTAA
GGAGATACAAAAACAAGAAAACTCAGGAAGAAATGAACAC
GAGAAATTTCAGCACAGCAAGAAAACAGCAGTGGATTTAA
GGCCTTTAATGGCGTCAGAGGGGTCACAGGAAGAGCTGGA
GTTTGAAATGGGTCAGGAAGACTTAGGGACAGTGTGGTCT
GCTGATCTATATATGGACGGAGGACCAGACGAATCATCAA
TACCACCAACACTAAGAGATTTCCCACACACACAAATGCT
GAAATCACCTCAGACTGTCTTTCCACCAGAATCAACATTG
TCAGCATTAAAAGACACTGCACCAATGGAGGCAATTACCC
AATCTGCAAGCAAAGTTGACCCTCCCTACCAAGACGAGAG
TACACAGTCTCTACCGCCAGTTCCTTTACAGGAAGTCGGC
CTTGATGCCATAAATCCTGATGTTAGTTTTGCAGCCGCTC
CACAGTGCGATGAAAGGCTAACCACTTTATCACACATAAC
TACAGAAACAGCAGCTGCAAACACTGAAATATGCAAAGAT
AATGCAGGAGAGACAAGTAGTAATAACTTGTCACCACTTG
AGGGCAACATTACCAACACTACATGTATAATCAACAATGA
AATTGAAAAACAAAGCATCATCAAGGCATCAGAAAGCTTA
ATTGTAGACGCCTCAGAAAGACCACAAGATGTAAACGTCA
ATGAGGATGTTTCTCCAAGAAGCTCAGTGGTTCCTTGGCC
ATTTCCTTCTCCTAAACTTGAAAGACACCTAGAGACTTCT
AAAAGCACAGATAGTTCAAGTGTAAAGAATGATGACCAGT
CGGAGGAGAGTGTTCTGTTAGAAAAGATCCGTCAAATGGC
AGAAGATGAAATGGCTAAACCAGCATCTACTCCCCCACGT
GCTAAAATACGCTTGATACCCTGCAAATCTGATTTCGAAC
TCCCTCCAACTCCACCTCTACAACTTAAATCCAGCATGAA
AACGCCCGTGGATGAGATGCAGTTACATTTAGATCAGACA
AAAATCACAAATCCACCTTCAGTGATTTTCCAGGAGCAAA
CAGACGAGGAGATTAATAACAGTCAGTCTCAGACTTCATC
TGCACCAATGGAGAGTTTTACGTTAGATGACAGACAGAAA
GAGGAAAGTGCTAATAATGCGGTTTTAGATGACAACGTCC
TGTTAAACAAGCGAGAACCAAACATCCAGCTGGAATGCGT
AGCAGCTGAAGGGGAGCGCCAAGATACGTCAGCTGCTGAG
CCCACAGAGAACGCAGAAACACAAGCTAAAACTGAGAAAG
AGGAACAACTAGATTTAAGTGTTGATAGAAGTGAAGAGAC
TCAAATGGAGCTGGATAAACCACCATCTCCTGTGCCTGAT
GAATTGAATAGTCATCCTCAGGAAAAAGAGTCCTCTAGTT
TGACCCAGGAACCTAAAGGGGTTGAGACACCATCTAAAAG
CCCAGACAGTGTGCAGGTCAATGGCCAGACCACCATAGAA
GCGTCGCATGTCATCGTGCCTCCAATGCGCAGTAAAAAGA
AAATAATCCCACCACCAATGGATCTCACACTGGTAAAATC
AATAGATGAGTCAAACAGAGACGGCTCAGCAGTGCCTGCG
TGGAGTTATGCCAGTCCATTGCCCAGTCCTGGTCTGGTGA
CCTCCACTCAGTCTTTGCTGGAATGGTGTCAAGAGATCAC
AAAGAAGTATAGAGGTGTAAAAATCACAAACTTCAGCACA
TCTTGGCGTAACGGCCTGGCTTTCTGTGCCATCTTACATC
ACTTCCACCCTGAGATAATTAACTTTGACTCATTGGAGCC
TCACAACATAAAGCAAAACAACAAAACTGCTTTTGATGGT
TTTGCTTCACTGGGCATCTCTCGTCTGCTGGAGCCCTCAG
ACATGGTGCTTCTCTCTGTCCCGGACCGTCTCATCGTCAT
GACGTACCTCAGCCAAATCCGCACCCACTTCACGGGACAG
GAGCTGAGCGTCCTACAGATCGAGCAGAACAATAGTCAGT
CCAGCTACACATTAGCTGGACCAAACCAGCGGCCCGATGT
TCAAGCGGCCACCAAATTCTGTGTGGAGAGACTCCAGGCT
GGAGCTTTTACTGGAGACAATAACAGTAAAGACTCAATTG
GGGAGGAGGAAAGCGAATCCAAGTCAAACGGAGGACTTGT
TGCTCCGCCGAGGACTAAGCGGACAGGAAAGGTGGATGGA
GAGGAGATAGACGGAGGTGTGCAGACTCCTGTGGCTCCTC
CACGACTGAACGCTGCTGCTGTCAGATCAGGGCTCGGACA
CTTGCGAGATGCAGATCTGGTGAAGAAACGACGGTCGAGG
ATGAAGAGCGAGTCTATGGACGAGCCTGATTCAAAAGAGA
TGCTACATGAGTCAGATAAAAGTGAACCAACAGTTGAAGG
AACAAATGGCTCAGCAGCTGCTAGAGAAAATGCTGAAGCA
GAACCTCAGGATGCAAACCAAGATGCCAAATCAGCAGATT
TTGAGACAATGTGTCTGCAGGACACCAATCAGTATGTATT
GAGTGAACTTCAGGCTCTGGAAACGGAACAGAAGCACATA
GACAGCAGAGCAGCGGTGGTGGAGAAACGCCTGCGAAGAC
TCATGGAGTCGGGGAGTGATAAAGATGAAGAGGAGAAGCT
AATTCAGGAGTGGTTTACTCTGGTCAACAAGAAGAATGCT
TTGATAAGGAGACAGGACCATTTGGAGCTGCTGCAAGAAG
AGCAGGATTTAGAAAGAAGGTTCGAGCTGCTGAACCGAGA
GCTCAGAGCCATGATGGCTATTGAAGACTGGCAAAAAACT
CAGGCCCAGCAGCACAGAGAACAGCTGCTGCTTCAGGAAC
TGGTATCACTGGTCAACAAGCGGGACAAGCTGGTCAGAGA
CATGGATGCCAAAGAGAGAGGGGCTTTGGAGGAGGACGAG
AGACTGGAAAGAGGTCTGGAGGCCAGACGGAGGAAATTTA
GCAATAAGGAAAAGTGTGTTCTTCAATAATAATAGTTTAA
AAAGTTAATATGGAACTGTGGCGATTGCAGCAGGACATTA
GTGTGCCTTGTTATAACTTCCTCACAACTTCAAGATCTCA
GTGGGATATAAAACACCTCCAGAAGTTTTTGCCTAAAGGT
TTGCACAATTTTGATGTTGTTTTTTTCTCCCCAGGCTGCA
CTGGTGTAGAGTTTGGTATTACCCAGGCACATTCTAAAAA
TGTACCTCTATATATTTTTGAAGACCGTCGAATATATCCT
AGGAGCTACGTTTATGTTTTTTGTTTTTTTGTTTTGCAAT
TTTTGTTTTTTGCAAATCCAGAAGAAGCCGCTGTGTATGC
TTTTTGAGATCTCAAATTTCTCTTGCGAGTGCCTTTTGTA
TCTGCTGTTCTCTCGTAAATCCACCAGAGGCCGCTGTTGA
CTGACTGACTGAATGACTGACTGACCAGTCGACTGACCCA
CCCTCCTCCTTCCCTAAACCCAACCCATAATGTTTTATAA
AGCACAGATTGACCCACCCACCCACTTTCCTAAACCCAAC
CGACAAATTTAAAAAGCAATTCAGAAAAAGAAAAGCCCTC
GCCTGATTTTTTTACCACATTCTTACCCTTTTATGTACTT
GTTTATTTTGTTTTTTGGTTTGTCTTTGTCTTACCCGCTT
TCGGGAACCCCTCTTCACCGAACTTGAACCCTGGGTCAGG
GTAATCTCCTCTCTGCGTCTCAATTCCACTAACGTACATG
GCGAGCTACCTAAACAAACTGGTAACAGCCGGAAAGCCGT
CCATACGGAGGTAAGTGGTCAGCTGGTAAGCGTGAAAAGG
AAAAGCGTCATACCGCCCCATAGCGTTCGTTTAAAAAATG
CAGCCATGCGTACTTCTGGCTACATAATTCACGATCTCCA
GAAATGTACATGGGGTACATTTCAGAATGAGCTTGTGTTG
CAACTAAAGCAATATTACTTTAATATTGAACAATAAACAC
TTTTCACACATCTGAATGGTAAACAATAAACTGAACACAG
TAAATTGCAGGAAGAAAACGGGAAAATCCTACACAATGCT
GCAGATCACAAGAAATCCTATATTTATTAACAGCATTTTT
TTGCTGAAGTGAAGAAAATATTCCTGAGTAAATAATAGAT
TTCTTGCAAGCTACAGCATTTAGGGTTTTCTCTGCTTTGT
TATGCTTTATTGTGAATGTAATATTTTTTCACAGACAGGA
ATAAGCCGGTTTGACTGTCATTAAGGTGTATGGAAAAGAC
AAAGAGAATTGCGCCAAAGTTTGCTGGTTTTACATTATTT
ATTGAAGTGTGTTGTTTGCTGGTATGCCAAAATGTGTCTG
TCGGGCTGTTGTCTTGCATTAGTTGCAAAATGTGTTTTGA
GACGGTATGTGTCTCCAAATGAATGTATTCATGAAATGAT
TTTGCATTGCAGTGCCTTTAGAGGTTTATTACCTTTCCAA
AAGGGGCTTTTTATATACAGTCAAGCCATTCTGTATTTTT
CTGTTTTAAATCTCGACAAGTTCATTCAAAATAAGAATGA
AACAAATATTTATAGATTGTTTTATAGATGTACAACAAAA
GTATTTTGTCAGACTGTACACTTTTTTTGATATGTTAATG
TGTTATTCATTCCTATTTTAAGAGTTAGGGTGTTTTATTC
AATAAAGTTTGATGCTGTTTGAATT

ehbp1l1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ehbp1l1b-201 9265
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ehbp1l1b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000043201 (1),  Ensembl_Trans:ENSDART00000089205 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE709825 (1) 850 bp
GenBank:AL914820 (1) 539 bp
GenBank:AL914821 (1) 539 bp
GenBank:EB782139 (1) 395 bp
CITATIONS (2)