ZFIN ID: ZDB-TSCRIPT-091110-162
Transcript Name: hephl1b-201
Previous Names: ch73-280o12.1-001, ch73-60g14.3-001, hephl1b-001, si:ch73-60g14.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043156 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043156|OTTDARG00000031041|ZDB-GENE-091204-388 hephl1b|OTTDARP00000034219 CH73-60G14.3-001 LG_none CT573163.5,AL929315.8 Danio rerio protein_coding NOVEL, 3723 bp
CTCTTCCAACAGGGAAGGGCTTTCCATGAATTTAATGGGT
GTGTAAAAGGCTGTTATCATGGCTCATGACTGGTCATCTT
CATTGCTCTGCTGTCATATTATAATTCAGGGCTTCGCAGA
TCTCTGCTGCAGAATTATTTGAGAACCCTAGCTGGGCAGT
TGTGTTCTTTCGGAAACTATGCTTTCTTTCCTGGAGTTTT
TGGGAAGCTTGAGCATCTTCTGTGCTGTATTAGCCCAGGC
GTCTGGAATGGAAAGAATCTTCTATATTGCGATTCGAGAG
GAAGAGTGGGATTATGCACCAAGTGGACAGAATCTGATCA
ATGGGAAGCGTATTGAAGAGGATGAGCAGGCATCAGTATT
TCTGCAACGTGGGGCTCGGCGGATTGGCAGTGTGTATAAA
AAGGCAATTTACAGGCAGTACACAGATTCTTCTTACTCTC
AGGAGGTCCCCAAACCCCCCTGGCTGGGTTACCTGGGGCC
CATCATGAGGGCTGAGGAGCAGGATGTTATCATAGTGCAC
ATGAAGAACTTTGGCTCCAGACGTTACTCCATGCATCCAC
ATGGCGTCTTCTATGCCAAAGACTCAGAAGGTGCGTTGTA
TCCAGACGGAACCTCAGACAGTCTGAAGCAAGATGACGGT
GTTCCTCCAGGGGGAAACTACACCTACACCTGGATTGTGA
AAGCAGAATCTGCCCCTCAGAAGGATGACCCAAACTGCCT
GACATGGGCCTACCATTCACACGTCAGTGCTTCACAGGAC
ATCTCCTCTGGCCTTATTGGAGCTCTTCTCACCTGCAAGA
AAGGAACCCTGTGTGAGACGTCCACTTCCGATCAGCACCA
CGCTCATCGTGAGGATGTGGACCAGGATCTCATCCTCATG
TTCAGTGTGGTGGATGAGAACATCAGCTGGTATCTAAAAG
AGAACATCCAGAGCTTCTGCTCCGACCCAGATGGTGTGGA
TCCTGCAAGTGAAGACTTCCAAGAATCCAATTTGATGCAC
GCCATTAATGGATATGTGTATGGAAACCTACCGGGGATTG
AGTTTTGTCAAAACCGCACAGTTGCTCTGCATCTCTTTGG
CATGGGCAATGAGATCGACATTCACTCAGTTTATTTCCAC
GGGCACACACTTCTGGACCGCGGGCACCGTGTGGATGTCA
TGAGTCTGTTTTCTGCCACTTTTGCCACTGCAAACATGAT
TCCTGCCACAATAGGGACGTGGCTGTTAAACTGCCAGGTC
AATGATCATCTGCAAGCTGGTATGCAGGCACTGTTCAATG
TGTCGTCCTGCAGTGATGAGGCGAGCTCCACGGCTCCTCT
CAGTGGGAAGATCAGGAAGTATTTCATTGCTGCTGAGAAG
GTTCAGTGGGATTACGGACCATCAGGGATGAACCAAGTGA
CCAAGGAGTCTCTAATCGATCCTGGAAGCTTTTCAGAGGT
TTTCTTTGGGACCAATAATAGCCGAATTGGTGGAAAGTAC
TGGAAGGTGATATACAGAGAATATACAGATAAGACTTTCA
CCTTAAAGAGAAAGCAAACCAGTGCTCAGACTCATCTAGG
CATTCTGGGTCCAGTACTGAGGGCAGAGGTTGGAGATACA
CTTCAGGTGATGTTCATGAATAAAGCTGACAGAAACTACA
GTATCCAGCCTCATGGACTCCAGTACGACAAACCCTTCGA
GGGAGTATTTTATCAAGATGGTATAAAGAGAAAAGGATAT
GAAGTTCAGCCAGGTGAAACGTTCACCTACATGTGGAAGT
TGAGGGAAGGACCGTCTGAAAGTGACCCCCCCTGTATTTC
CTACCTGTACTTTTCCTCCAGTGATGCAGTCAGAGACACT
AACTCTGGCCTCGCAGGCCCCCTGCTGGTGTGTAAGAAAG
ATGCGCTGACATCAAGTGGCACTCAGAAAGAGGTGGATCA
TGAGTTTTTCCTGCTTTTTACTGTGTTCAATGAAAACCTC
AGCTGGTACTTGGATCAGAACATTGAAACCTTTGGCACCA
ATGAGTCAGACCCAGAAAATCTGGACTTTCAGGAGAGCAA
TAAAATGCATGCTGTGAATGGCTTCATGTATGGGAACCTA
CCTGGCCTTGAGATGAATAAGGGGTCCAGGGTCAGATGGC
ATCTTTTAGGACTTGGCACAGAGATGGACATTCATGGCAT
TTACTTCCAAGGCAACACCTTCGAGAAACAGGGCACAACA
CATGACACTCTGAGCCTGTTTCCACACACTGCAGTCACTG
TTTTCATGCAACCAGATGTCAGTGGTGTATTTGAGCTGAG
CTGTCTAGTGTGGGATCACTATGATAGTGGGATGAGACAA
CTGTATGAAGTGACAGGACCAAGATATGAAGAGCCCTCAG
TCTCACCATCTGAGACAGTGGAGTATTTCATCAGTGCTGA
AGAGCTGGAGTGGGACTATTCGCCTGATCGCACATGGGAA
CTGCAGAACTTCAACACAACGGAGGATGAAAGTCCTGGCA
GTCTATTTGTAGGAACAGGAGGAAACAAACTGGGCTCCAA
GTATAAGAAAGTAGTTTATCGAGAATACACCGACGCCACC
TTCAGGACAAGAATAGAAAGAGAACCTCATGAGACACACT
TGGAGATTTTAGGGCCTATGATCAGAGCTGAAGTTGGCCA
GGTTTTGTTGATCACGTTCATGAATAAAGCTAGTCATGCT
TACTCGATACAAGCACATGGAGTCAGATCTTTTACTTCAA
AACCTGAGGCCGTCATGCCAGGTAATATGACTCAGTACCA
GTGGATCATTCCGGAGAAATCCGGTCCAGGCGTGTCTGAT
CCAAACTGCATTGCTTTTGCCTACTGCTCAGCTGTGGACT
TTGTTAAGGATACAGCCAGTGGTCTGATTGGGCCATTAAT
GATCTGCAGGAAGGGAACACTGAACCAGGATAGACAGAGA
ACTGATGTGGACAGAGAATTTGCTCTCCTTTTCATGGTGT
TTGACGAGAACAAATCCTGGTACCTGGAAGAAAACATTGA
ATCCTACTACAACAGCTCAGAACCTCTTCTAAGAGATGAC
GAGTTTCAGAAAAGCAACAAGATGTATGGGATAAATGGAA
AAGTCTATGCAAATCTTCGGGGACTGGAAATGGTGGTAGG
GGAAAGAGTGGTCTGGTACTTGTTTGGGATGGGTAATGAA
GCAGATATTCACACCGTCCATTTTCACGCTGAGACCTTCA
CCTACAAGACAGATCATACTCACCGTACTGATGTGTATGA
CCTGATTCCGGGGTCATTTCAGACATTAGAGATGGTGGCA
GAGGTCAATGGAACATGGCTTCTGCACTGTCATGTCTCAC
ACCACATCCTTGGTGGAATGGACACCACTTTTATCATCAA
ACCTCGATCAGGTGGTGACTCTGTGAGGAGAGATTTAAAC
ATCATTTGTGTGCTGATCACAACATTCATGTTCAAACTCA
TATATTGATCCTTCTGTAGACATATATTGTACTTAAATAC
TCTTAACAAATATATTTAAGCAGTGTTCAAAAGTTTAGGG
CCAGTAGGATTGTCTCCCCTCTTATGATCACCAAGGTTTA
TGAAAAATACAGTAAAACCTGTATTGTGGAATATGATTAA
TTTCAATTTAAAAGTTTTTTGTTTGTTTGTTTTGTTTTTA
GTGTCAGTTCTGCTTAATATTTTTGTGGAAACCATTTTTC
GCCAGGATTGTTTAATGAAGTAAAAAAAAAGCAATTGTTT
GAA

hephl1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hephl1b-201 3723
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hephl1b-201 Contained in:
[BAC] CH73-60G14 (1), CH211-69K21 (1)

Genome Resources: Vega_Trans:OTTDART00000043156 (1),  Ensembl_Trans:ENSDART00000135985 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB877900 (1) 709 nt
GenBank:FP126852 (1) 674 nt
CITATIONS (2)