ZFIN ID: ZDB-TSCRIPT-091110-1596
Transcript Name: pigo-001
Previous Names: dkey-106m10.4-001, dkey-200l5.3-001, si:dkey-200l5.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043051 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043051|OTTDARG00000030971|ZDB-GENE-091204-80 pigo|OTTDARP00000034155 DKEY-200L5.3-001 LG_ CR925808.19 Danio rerio protein_coding NOVEL, 4782 bp
TGGAAACCGGGCAGCGAGATGATCAATATTAAAACAAACC
CGCCGTGCTTTAATAAAGCCGCATGTCTCCACGTGTAGAG
CAACAGTGAGGCTCAGACAGACCGGGCGGCAGATGCCGGA
GACCCTGCGGCTCTTCAGTGCTCCTGCGGCGGCTTTCAGT
TCCTGAAGAGAGCGAGAGAGAGGACGAACACGGAGCAAGA
ATGAGAAGACTTCCCATTCTCCTCGCCCTCCTCTGGGTCT
GCTCAGTGTTTTACGTGGGCATCTTCCTGTTTGTGGGAGG
CTTTCTCCTCGTCCGGCTGGAGGTCAACAGAATGAGCACC
TGTGCGGACGTCTTGTCTCCAGTAGCTCAGCTGAAGGGTG
ATTTCTGCCTGAGCGAGCCACGTTTTCGCAGGGCAGTGGT
GTTGATCATCGATGCTTTGAAGGCTGACTTTACCCGATAT
GATCCGGAGAATGCGGCACCCAAACCCTTTGAAAACAAGC
TGCCGGTGTTGGATGAGATGGCATCAGCACATTCCTCTCA
TGCCAGGCTGTACACCTTTCGGGCCGATCCACCCACCACT
ACCATGCAGAGGATTAAAGGCTTCACAACAGGCTCTCTGC
CCACTTTTATTGATGTGGGGAACAACTTTGCATCCAATGC
AATCCTGGAAGACAATCTAGTGCACCAGCTGGGACAAGTG
GGTAAGAGAGTTGTTTTTATGGGGGACGATACATGGGTGA
GTCTCTTCCCAAAGAAATTCCACAGATCTCTGCCCTTCCC
CTCCTTTAATGTGAAGGACTTGCACACCGTGGACAATGGC
ATTCTCCAAAATATTTATCCTACCATGGAGGGGGATGATT
GGGATGTGCTGATTGCACATTTCCTGGGTGTGGATCATTG
TGGGCACAGATTTGGCCCGGATCACCCTGCGATGGCAGAA
AAACTCTCCCAGATGGATGGAGTTATTAGGTCAGTGATTA
AGCGTCTGAAGAATGACACCCTGTTGGTGGTAATGGGAGA
TCATGGAATGACAGACACTGGAGATCATGGTGGAGAGAGC
CAGAAAGAGACGGATGCTGCTCTGTTTCTCTACAGCTCCT
CTCCCTTATTTCCTGCACCAGGCTCCCAGGTGGAACCTGA
GGTAGTACCTCAGACTGATTTGGTGCCCACACTGGCACTA
CTGCTAGGAGTTCCTATTCCCTATAGCAGTGTGGGCCAGG
TTCTCCTGCCACTCTTTCCTCAGAATGGCTCCCGGGGTGC
ACCTACAGGTCTCAGCCAGGCTGAGGCGCTGTGGATTAAC
GTCAAACAGGTAAACCGCTTCTTGGAGACCTATTCCAACA
TGGCCAAAGACATCCCACCAGATAGTCTGTCTCAGCTGCA
GGCTGACTTCTCAAACATTTCCTCCCAGTACTTGTCTGCT
GTCCACAAAGGTCATCTCCCGCCTCTTAAACTAGTCATCT
CCATGCAGAACTATCTGACAGCTGTCAGGGAGACTTGTAG
AGCCTCCTGGGCTCGATTCAACCCTTTCAAAATGGCTGCT
GGTCTATTAATCTTGGCGGTTTCCTGTGTCCTGTGCTACG
CCCTTTCTGAGTTGTCTTGTGTAGTCGTTCAGGAAGGCTT
GCTCAAGTTGCCTATTCTCTCAGGGCTGGCAGTAGGACTA
GTAATAGCTGCAGGTCAGCTGTTTTTGCAAGGTTATTTGG
AGTTCTCATGGTGTTTAGGAACTGCAGCACTTTCATCTGA
GGTATTATTTCTGTGGAAGACACGTAGAGTTTCTCAAAAA
TGTAGGTGGTCACTTTCTGGCCTCCTCACGCCAGCACTGC
TTGTGCTTTTCCTGCGCTGTGCCTCGCTGCTTTCGGACAG
CTATGTCATCTATGAAGGCCACGTGGTTACTTTTTTGCTC
TTCACATTGAGCATATATATTCCACTCCGTCTTAACTGGG
ATGGACTCCTGGTGCCACTTCCTCCACCAGACACCCAGAA
GCCTCCAAGGTTGCTGCCAACAACACTGCCATCGTCTGTG
GTTAGACGTGAAGCCTCTGTGTTGTTGGTGTGGTTGGGAG
TGCTGGTGGGGTCTCTATATGTATCCCTTTCCTTCCACAA
CTGCCGAGAGGAGCAGGGAACCTGCCAGCCCTCATCTTTC
CTCTCCCCGCTCTCGCGTGTACAGGACAGCCAGCTGCGCA
ACCTACACTATGTACTCTCTGTATTCTCGCTGGCCACATG
GGGGTACCTTCTACACCGTTGGCTGAGACACTATGGGAAC
CTGAACTGTTCCAGTTTGACTGTATTTACAGCCTGCTTTC
TCATACCACTGGCCTGTGTTTGCATTGGGTTGCACTGGGC
AGTGAGTGCCACCCCTGAAGACACCTTCCGGAGTTTGTCC
GAACTTATTGGCTTAGCCCAGGTGTTCCTGCCACGGGCTG
CCTTCTGCCTGTTGGGCCTGGGTTTGCTCCTGTTGTGGCT
GGACCCCATGACTGTGTTCCTCAAGACAAGGACTCCATTG
AGCTCTCGAGGAACATCCCTGCCACCCCCTAAATATAGAG
CCAGCACGGGAATCAGTCCGCAAGCTGAACTGCACCACCT
GATCCCACAGCTCTATCAGCGCATCCGACACTCGCTGGAG
GACGGAAGCACAGATAGTGGTGAAGTAGACAACAGGCCAG
CTGTGGAGGCTTATGGGCTGGGTACAGTGTACTCTGCTCC
TTTGGTCCTGCTTTGTGGACTCTTGGGGTTGGTGCTTCTT
CTACTCCATCCAGAAGGAATGGCCCTTGCCTTCCTGCTTC
TCCTCTTGGAAGCAGGAGCAGTGCTGCACATTCATGCCTG
TAGCACCACCCTCTCCAGCCTGCATAAACACTCCAATGAT
TTCAGTGTTCCATGGGCTCCAGTGGTTTCATGGTCTCTGG
CGGCTGCCCAGTTTTTTCATGCTTCCGGACACCTACCAAC
CTTCCCTTCAATACAGTGGGGTGCAGCATTTGTGGGCTTT
CCTCAAGGTCACACAGGGAATTTGCTTCCTGCCTCGTTGG
TGACCCTTAACACCTTTGCCTCACATATCATCTTTGCAGT
TGGCTGTCCTCTGTTGCTGCTCTGGCCTCTGGTGTGCGAG
GTGCGTGGGTCCCGATCTACACGCTCAGCAGGACTGGAGG
AGAGTGAGGATGCTGTCATGGAGATGAGACTGAGAGAAAA
CCCTCAGAATTTCAGCTCGTGTCTCCTGCAGCTCGCCGCA
CGTTACCTCTTTGTCAGTGGAGCACAGGTTTTTGCATCAG
TTTGTGCTGCAGCCATCCTCAGGAGACATCTCATGGTGTG
GAAAGTTTTTGCACCCAAACTGATGTTTGAGGCCTTTGGC
TTCATCGTGGGCAGTGTGTTTTTGATACTGGGAGTTGCCA
TGGTGATGAGGGTGGACCTTTCAGTGGGTGGTCTATTTAA
GAAACTCCTCCCTCAAAACTCCAGGTAGCACATGCTACCC
CTGATCACGCCCCCTTTCCCAATGACCACACCCCTTATCC
TAGTTGAACACATCCCTTACACCCATAAGCCCATCTAGGA
CTCTTCAAAGATGTGGTGGAGACACTTGGCCATCTATCTC
ACTGCCAACAATTTGGATGGAAATTTCATCTGGCTTTGGA
CCAGGGGTCTAAAGCATCTCCTCATTTTCAAAGTCAATAA
TCCGAAGTGTTTTATAAAAGCTATTCTAGAAGACTGCAAC
AGTCATAATGCTTTCAACAAGCTATTGAACTGTCAGCCTT
TGTTGCTACTGCCTTTTGTATTTGAAAAGAGCAAGACAAA
GGGAGATGATCTTTGTGCATGCCTTTTTTACTGCCATGTT
CCACAAGGTCATTATAGAGACGAATCAGACGATTAGAAGT
TATTATATTGAAGGGCTACATGAATCCATGGTGTTGCAAT
TGTATAAACTCTGAAAAAAAAGGAACAGTTTACCTAAAAT
AAAAATGATGTCATCAGTAACTCCCTTATGTCATTCCAAA
CTCAAAAGCTATCAAGCTGACTCTATATTATTAGAGGATT
GAGGGACATTTGTGGTCACCATACACCTTCATTTTGTTGA
AAACTACAGCACAACCTTCTGTGTTTTATGGAAGAAAGTA
AATTGTACATCTTTTGTTTGCAACGATGACAGTTTAATTT
TTAGTTGAGCTGTTCCTTTAAGACACAAATGCATGCTAGA
GGACATCATTATTACAGCAGTTGACCTTTATTTATTTTGA
GCATTATTTGATGATTGCTCATTGTTAATGTGAGTTTTGT
CTATTTCTTAGCAATAACCACCCAAGCATCAGGGTTGAAC
TAATTACACGTTGTGTTGTACACCATTTGAATGTGTGTTA
TTTTGGTCGGTTTTTCATTTTGGCTAGGAAATAACTGATA
ACAGGTCACTAGCTGTAATGGTTGCCTTGTTTGTTCTGAT
GTTAGTGAATGAAATGTGTATTCCTGCGGTTTGCATTGAC
TGTTATTTATTTAGTTCACTAATGGATTAAATGACTTCTC
TCATTTTTGTGAGAAATGCATGGGGAAGATAATTACATCT
TGTACTCAGGTTAATTTAGCCATAATGCAATAGTATTTTG
CTCTGCATGGTGCATTTGTGTGTGTGAGAGAGGGGCTGAT
TTAGTTATTTAATTGTTTTTTTTAAGGAAATACTGTCAAG
CCATAGAGTGGCTTTAAATAATGTCTTAATGTGTGGCTAA
TGATTGAATTACAGCTGTGAAATCATTTTAACTGTTCTAA
AATTGTTTCGATTCATCGCTAACGTTGAGTAAATCAATTA
AATATTTTGTACAATTTGAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pigo-001 Contained in:
OTHER pigo-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043051 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CA473796 (1) 887bp
    GenBank:DR725153 (1) 826bp
    GenBank:CT647717 (1) 679bp
    GenBank:BM778484 (1) 640bp
    GenBank:CT599839 (1) 602bp
    GenBank:BF156913 (1) 553bp
    GenBank:BG799742 (1) 498bp
    CITATIONS (1)