header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1537
Transcript Name: actr1-202
Previous Names: actr1-002, snag1-001, ottdart00000042861, zgc:56317-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042861 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042861|OTTDARG00000008461|ZDB-GENE-040426-2695 actr1|OTTDARP00000034026 actr1-002 LG_ AL935178.12 Danio rerio protein_coding KNOWN, 1239 bp
GGTTGACGCATCACCGCTCAGCCAGGGTTTTTACTGCTGA
GCAGCGACGGTTATTTTTATTTACATGCACAGAAAATCAT
AAACGGGGCTTCTTGCGAACGAATTGACCGAAAAACGCAG
CCAAGCGCAGGTTGAACATGGAGTCGTATGATATTATAGC
CAACCAGCCGGTTGTGATTGATAATGGGTCGGGAGTTATC
AAGGCAGGCTTTGCTGGAGATCAGATCCCCAAATACTGTT
TTCCAAATTATGTGGGTCGACCCAAGCATGTTCGGGTGAT
GGCTGGTGCACTGGAAGGCGATCTGTTTATTGGACCTAAA
GCAGAGGAGCACCGGGGTCTGCTGTCTGTTCGGTACCCAA
TGGAACATGGGATTGTGAAAGACTGGAACGACATGGAGCG
CATCTGGCAGTACGTGTACTCGAAGGAGCAGCTGCAGACC
TTCTCTGAGGAGCATCCTGTACTGTTGACGGAAGCCCCGC
TGAACCCCAGTAAAAACCGTGAGCGAGCAGCAGAGGTGTT
CTTCGAGACCTTCAACGTGCCTGCGCTCTTCATCTCCATG
CAGGCGGTTCTCAGTTTATACGCCACAGGCCGAACCACAG
GTGTGGTGCTGGACGCTGGTGACGGTGTGACTCACGCCGT
GCCCATATACGAGGGATTCGCCATTCCTCACTCCATTATG
CGTGTGGATATAGCTGGACGGGACGTCTCCCGGTACCTCC
GTCTCCTCCTGCGCAAGGAAGGCTATGATTTCCACACCTC
TGCAGAGTTTGAGGTGGTGCGCACCATCAAGGAGAGAGCC
TGCTACCTCTCCCTCAACCCTCAGAAGGATGAAACTCTAG
AAACTGAAAAAGCACAGTATACCCTCCCTGACGGAAGCAC
TCTAGATATCGGCCCTGCGCGGTTTAGGGCTCCGGAGCTT
CTCTTCAGGCCAGATCTGATTGGAGACGAGAGCGAGGGCA
TTCATGAGGTGCTGGCCTTCGCCATTCAGAAGTCCGACAT
GGATCTGCGACGCACGCTCTTCTCAAACATAGTGCTGTCC
GGAGGCTCGACGCTCCTCAAAGGTTTTGGAGACCGGTTGT
TAAGCGAAGTGAAGAAACTTGCCCCCAAAGACGTTAAAAT
TAAGATCCGTCATTGGGATGTAGAGCATCTTGGTCGTTTT
TCTTTTTAAGAGATATAGAAATATCATCATAAGCCTTGTG
TACAGTGGGTTGCTATTCAAAACTGTTAAAAAAAAAAAA

actr1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA actr1-201 (1) 2540
actr1-202 1239
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actr1-202 Contained in:
OTHER actr1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000042861 (1)
  • Ensembl_Trans:ENSDART00000075303 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC097070 (1) 1244bp
    CITATIONS (2)